a) As the percentage of AT base pairs increases the melting point of the molecule decreases. i.e., they are inversely related. This is because AT bases have 2 hydrogen bonds between them in comparison to GC bases that has 3 hydrogen bonds between them. As the molecule require less energy to break hydrogen bonds in AT-rich condition it would have less melting temperature
b) According to the tm calculation formula (Tm = 2 * (A+T) + 4 * (G+C)). The tm of the given DNA is as follows : (ii) 31.5 < (i) 37.4 < (iii) 43.2
Shown below are the sequences of three duplex DNA molecules. I. 5" AGCCTAACTGCGAT 3' II. 5'...
5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If false, explain why. a. [A+C] = [G+T] b. [A+G] = [C+T) c. A=G and C=T d. A/T=C/G e. [A+T] = [G+C] f. C/A=T/G 6) (3 pts) Listed below are the base compositions of three different duplex DNA molecules. L S'ATTCTAACTTTGAT 3' 3' TAAGATTGAAACTA 5 IL S'CGCACTGGCTAACC 3' 3'GCGTGACCGATTGG 5' II. 5'CGCATTATTGTCAA 3' 3'GCGTAATAACAGTT 5' a) Order these three molecules in terms of their melting...
6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA melting. In this process, two strands of a DNA molecule can be separated by heat without breaking any covalent bonds. Every unique DNA molecule “melts” at a different temperature. Determine the order of the DNA sequences listed below according to relative melting temperatures (lowest Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules. [3 pts] A. CTGAATCA B. CAGTGTCT...
Below is a single strand of a DNA duplex. Please write down the sequences of the forward and reverse primers that will anneal to the areas of the duplex represented on this strand in bold? Write these primers down 5'-3' (2 marks Primer 1 Primer 2 5'-ATGGATCGATACGGTAACGATCTCTCTCATGCTTTGGACACGAAAGGCATTCT-3' Primer 1 = Primer 2 = Then estimate the approximate Tm of primer 1 and primer 2 (2 marks). Primer 1 Tm = Primer 2 Tm =
QUESTION 44 west Because hydrogen bonds hold the two strands of a DNA molecule together, the strands can be separated ("melted") without breaking any covalent bonds. To melting temperature) is the point at which two strands separate, or become denatured. Order the DNA sequences listed below, according to relative meting temperatures from Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules at room temperature i) CGGCGAGCCAGCCCCG 11) TTAATTGITTGTCTCT iii) GTACCCGTCCTGTGAC iv) CCTAATAGACGCTGOT OAI<tcllci Biliv Ochellesi...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
.1. Listed below are features of biological molecules. For each, indicate if the feature describes a characteristic of DNA, or RNA, neither DNA nor RNA, or both DNA and RNA. Single stranded Contains hydrogen bonds Is a long molecule Contains covalent bonds Is translated to protein Contains complex carbohydrate Contains thymine Double stranded Is a short molecule Contains uracil Has peptide bonds Contains nucleotides Contains guanine Is confined to the nucleus Makes a replication fork 2. What is a protein? 3. A peptide bond (check "Yes" if correct; "No" if incorrect): Yes Ne A. Joins nucleotides in a...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
The following diagram shows the chemical structure of double-stranded DNA. 0- i. ii. Label the 5' and 3' ends on each strand. Indicate with an arrow the hydrogen bonds in the structure above. (4 marks) (1 mark) (a) Name the bonding between the adjacent nucleotides on a DNA strand, and (b) give the total number of this bonding in the structure above? (2 marks)
CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below to amplify the target region highlighter in pink (which could be an important gene such as insulin that you want to make many copies of). At this point, the double-stranded DNA has been heated so that the strands are now in a single-strand formation. Be sure to pay attention to the DNA sequence and the 5' 3'ends of the primers. 5' GG CCA A...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...