Homework Answers
To amplify the pink region, primer pair against the region B and C will be best option as the 3'OH region or the growing sides of the primer will grow towards the pink site.
Now, the primer sequences will be just the complementary sequence of the template.
Region A: 5'-GGCC-3'.
Region D: 5'- TTTA-3'.
Region C: 5'-GGCC-3'.
Region B: 5'-TAAA-3'.
Add Answer to:
CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below...
Now. you should be able to answer the following questions: • How the amplification will be...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
Which of the following statements about Polymerase Chain Reactions is wrong? a. DNA is briefly heated...
Which of the following statements about Polymerase Chain Reactions is wrong? a. DNA is briefly heated to break the hydrogen bonds holding two strands together. b. Primers hybridize to sequences at opposite ends of the target sequence on the same strand. c. DNA is cooled to allow primers to form hydrogen bonds with the ends of the target sequence. d. The three steps of PCR are denaturation, annealing, and extension. e. PCR produces specific DNA fragments for cloning. f. Taq...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.
1.The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the...
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+ Incubate the reaction appropriately. • Degrade the RNA strand with base, leaving just the cDNA. • cDNA is produced, which is single-stranded and complementary to the RNA of interest. • Double-stranded DNA for the region of interest is produced. • Add two primers (one...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exp...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
Please help with all questions. I provided all the information that I have. The sequence below...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+ Incubate the reaction appropriately. • Degrade the RNA strand with base, leaving just the cDNA. • cDNA is produced, which is single-stranded and complementary to the RNA of interest. • Double-stranded DNA for the region of interest is produced. • Add two primers (one...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago