
a)
During polymerase chain reaction (PCR), the number of double stranded DNA pieces is doubled in each cycle.
Therefore, after n cycles, total number of the copies of double stranded DNA would be 2n
So after 40 cycles, total number of 303 bp long template would be 240 copies= 1,099,511,627,776 copies
b)
To facilitate the separation of double stranded DNA into single stranded DNA, the initial denaturation step is carried out at the beginning of PCR. Initial denaturation steps aims to complete denaturation of the template DNA.
The initial denaturation step is commonly performed at 94–98°C for 1–5 minutes.
The temperature and time used for initial denaturation steps in PCR is greatly influence by the following two properties of template DNA
1) Nature of the template DNA: whether the template is a mammalian genomic DNA or a plasmid or a PCR product i.e. based on the nature of the template, the temperature for initial denaturation may vary. For example, as the mammalian genomic DNA is more complex and larger in size, it require longer incubation period than plasmid for initial denaturation.
2) GC content of the template DNA:
Template DNA with high GC content require higher temperature and longer incubation for initial denaturation compared to the DNA template having less GC content.
c) Suggestion
Generally the length of the PCR primers are 17- 30 bases. The bases in PCR primers may be counted i.e the number of A, T, G and C may be counted and as per the formula given in the question the Tm of the PCR primer (Detail of PCR primer is not available in the question) would be calculated.
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exp...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
You decide to use PCR to determine if your genotype for the PTC tasting gene TAS2R38. You then decide to also determine genotype for another gene called PER3. What PCR "ingredient" would be different in these two tests? Select one: a. Template gDNA b. dNTPS (nucleotides) c. Taq DNA polymerase d. Primers
1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2. Suppose you begin a PCR reaction with 1 piece of double stranded DNA. After 30 cycles of replication, how many pieces of double stranded DNA do you now have? 3. What would be the consequence of having too much DNA in the sample? Would it interfere with the PCR reaction? Why? 4. What happens during the annealing step of the PCR reaction? During the...
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
1-The genetic disease called alpha1 antitrypsin deficiency is caused by a mutation of the SERPINA1 gene. The version of the gene called M produces normal proteins. The S version and the Z version produce mutant forms of the protein that can lead to lung and liver damage. a. If someone has two copies of the M version (MM), this is their: Circle or Highlight ONE: genotype phenotype? 2-In our lab, why did everyone have two copies...
You are interested in cloning a gene from the B. sanfranciscus genome, so you design PCR primers that should amplify a 1 kilobase pair (kbp) PCR product that contains the gene of interest. After amplification, you will see if the PCR was successful by loading the entire reaction onto an agarose gel and performing electrophoresis to see if a product of the expected size was generated. To visualize the DNA, you will stain the gel with a fluorescent dye called ethidium bromide, which...
You are using PCR to amplify a 300 bp target sequence, a portion of Gene X, from human genomic DNA isolated from patients' blood samples. The instructions for this procedure tell you to include Samples A and B, whose contents are listed below, with each batch of patient samples that you run. Ingredients Sample A Sample B 10x PCR Buffer (Tris,KCI,MgCl2,BSA) 5 mL 5 mL H2O 37.8mL 38.8mL dNTP's 3 mL 3 mL Taq DNA polymerase 0.2 mL 0.2 mL...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction D. All of th C ONA as a template to form RINA D All of the above 7. PCR technique does not need A. Tag polymerase B Restriion encymes C Olgoucletide prmers C. A fragment of skin D. All of the above 9 PCR can be used in A Cloning B.Sequening C.Medical dagnosis&foric mine 0.PCR can make mullple copies ot A. DNA B RNA...