Question

1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2. Suppose you begin a PCR reaction wi
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question 1

Answer: Degenerate primers are a mixture of oligonucleotides that are similar (Codes of same amino acid sequence) but not identical (different in nucleotide base composition). These primers are designed based on conversed aminoacid sequence of the protein. As each aminoacid is coded by more than one codon, these primers are designed in such way that they have all possible combination of bases that codes for same aminoacids.

Degenerate primers amplify the same gene from different organisms.

Question 2

Answer: During PCR, the amount of DNA is double after every cycle and hence the number copies of DNA after n cycle is caluculated using the formula of 2n.

If you start with a one piece of DNA. After 30 cycle of PCR, the number of pieces of double stranded DNA after 30 cycles is 230 = 1.02 x 109 copies.

Add a comment
Know the answer?
Add Answer to:
1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1.The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the...

    1.The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, in Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95°C. a.Why would such a heat-stable polymerase be beneficial in PCR? b.What would happen if it weren’t heat stable? c.How might you choose...

  • 1) What does PCR stand for and what does it do? a. Polymerase Chain Reaction; PCR...

    1) What does PCR stand for and what does it do? a. Polymerase Chain Reaction; PCR deletes DNA b. Polymerase Copying Repeats; PCR amplifies DNA c. Polymerase Copying Releats; PCR deletes DNA d. Polymerase Chain Reaction; PCR amplifies DNA 2) During gel electrophoresis, the DNA fragments are separated by ____ a. charge b. DNA fragments cannot be separated c. color d. size 3) Primers are a. double stranded DNA oligonucleotide (fragment) b. double stranded RNA oligonucleotide (fragment) c. single stranded...

  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • 2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exp...

    2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...

  • Identification of unknown Bacteria by sequencing rDNA Having a little trouble understanding the PCR process. This...

    Identification of unknown Bacteria by sequencing rDNA Having a little trouble understanding the PCR process. This is a lab we did and some homework questions regarding the sequencing rDNA to find unknown bacteria. I hope by answering these I can have better understanding of the process. The more descriptive the better. Thank you! 1. A. Name the gene that we will be sequencing in order to identify the unknown. Explain why this region is considered to be the target for...

  • 3’-TATAAAGACTTACAAATTTGTCCCCATTTTGC-5’ 5’-ATATTTCTGAATGTTTAAACAGGGGTAAAACG-3’ a. Diagram the results you would obtain for 1 and 2 rounds of PCR replication using the primers, 5’-ATGTT-3’ and 3’-CCATT-...

    3’-TATAAAGACTTACAAATTTGTCCCCATTTTGC-5’ 5’-ATATTTCTGAATGTTTAAACAGGGGTAAAACG-3’ a. Diagram the results you would obtain for 1 and 2 rounds of PCR replication using the primers, 5’-ATGTT-3’ and 3’-CCATT-5’ and template above. b. The primers in part b were designed to make it easy to illustrate the PCR process, in practice PCR primers are 18-25bp in length. Why do PCR primers that are 5bp fail? c. Are primers used in PCR RNA or DNA? d. Explain how PCR amplifies the gene of interest without amplifying the...

  • 1. Using your understanding of PCR amplification answer the following questions: a) How do you know...

    1. Using your understanding of PCR amplification answer the following questions: a) How do you know if a primer dimer is created during PCR? b) What is nonspecific PCR amplification and how do you know if it exists during PCR? c) What are the possible results you could expect to observe on the agarose gel from your PV92C results? Use a schematic diagram and draw a gel to illustrate where the PV92 primers bind. You should also consider where the...

  • 3’-TATAAAGACTTACAAATTTGTCCCCATTTTGC-5’ 5’-ATATTTCTGAATGTTTAAACAGGGGTAAAACG-3’ a. Diagram the results you would obtain for 1 and 2 rounds of PCR...

    3’-TATAAAGACTTACAAATTTGTCCCCATTTTGC-5’ 5’-ATATTTCTGAATGTTTAAACAGGGGTAAAACG-3’ a. Diagram the results you would obtain for 1 and 2 rounds of PCR replication using the primers, 5’-ATGTT-3’ and 3’-CCATT-5’ and template above. b. The primers in part b were designed to make it easy to illustrate the PCR process, in practice PCR primers are 18-25bp in length. Why do PCR primers that are 5bp fail? c. Are primers used in PCR RNA or DNA? d. Explain how PCR amplifies the gene of interest without amplifying the...

  • Please help with all questions. I provided all the information that I have. The sequence below...

    Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc   1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...

  • 1. Explain why, when PCR is used to amplify the same region of DNA from two...

    1. Explain why, when PCR is used to amplify the same region of DNA from two different people, the size of the DNA fragment(s) generated may be different? 2. What characteristic of the DNA molecule makes it possible to use electrophoresis to separate DNA molecules by size? Explain why this characteristic is important for electrophoresis and what part of the DNA molecule creates this characteristic. 3. You are performing PCR. After four cycles of PCR, how many double-stranded copies of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT