Question

The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...

The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The DNA primers used in PCR are

Answer- a. complementary to DNA sequences at both ends of the DNA sequence of interest.

DNA primer binds to complementary regions in DNA.

PCR is a polymerase chain reaction. PCR is a technique that helps in making multiple copies of the DNA sequence.

Please give a thumbs up!!!!!!!! Ask any doubts regarding the above question in the comment section !!!!!!!!!!! Thank you!!!!!

Add a comment
Know the answer?
Add Answer to:
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...

    1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...

  • To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...

    To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...

  • Which of the following is the correct order of events in the polymerase chain reaction (PCR)?...

    Which of the following is the correct order of events in the polymerase chain reaction (PCR)? See Section 20.2 (Page 468) cooling to allow primers to attach; heating to separate double-stranded DNA; elongation of DNA strand as nucleotides are added elongation of the DNA strand as nucleotides are added; cooling to allow primers to attach; heating to separate double-stranded DNA heating to separate double-stranded DNA; cooling to allow primers to attach; elongation of DNA strand as nucleotides are added heating...

  • S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...

    S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...

  • find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at...

    find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...

  • QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1...

    QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1 Which of the following is not valid about how Primers work for PCR Having a sequence that anneals in the range of 56°C to 60°C depending upon design. Having the same sequence as the 'template DNA' in the gene of interest, about 20-30bp in length. Using sequences that are as close to 50% GC vs AT as possible. Using a sequence complementary to the...

  • True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that...

    True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that encodes for ampicillin resistance. The ends produced by the endonuclease can be rejoined by a ligase, which closes the break in the hydrogen bonds formed by the complementary DNA nucleotides. Restriction recognition sites typically have a palindrome structure. During DNA ligation, DNA fragments with compatible sticky ends have a higher ligation efficiency than DNA fragments with blunt ends. PCR is a technique used to...

  • Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)?...

    Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)? Question 16 options: A) Nucleoside triphosphates that serve as the source of the nucleotides A, T, C, and G needed in the synthesis of the new strands of DNA B) A restriction endonuclease enzyme that cleaves DNA at specific locations C) The segment of DNA that must be copied D) A DNA polymerase enzyme that will catalyze the synthesis of a complementary strand of...

  • DNA fragments cut by most restriction enzymes have: double-stranded complementary ends. either only sequences of Gs...

    DNA fragments cut by most restriction enzymes have: double-stranded complementary ends. either only sequences of Gs or only sequences of Cs. cuts made at random points along one of the strands. protruding sticky ends.

  • PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The...

    PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT