Question

S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequen
MCB 2400 -DNA Synthesis Primer Design 6. Researchers often need to design PCR primer pairs in order to conduct their investig
0 0
Add a comment Improve this question Transcribed image text
Answer #1

3. Write in the following sequences to depict them hybridizing/annealing to complementary and antipallwence in the exposed nu

Please rate high.

Add a comment
Know the answer?
Add Answer to:
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select...

    The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select all of the options below that are true. 1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...

  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • This PCR step is called annealing. The annealing step follows the denaturation step: it is usually...

    This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...

  • pls help The DNA sequence below is 300 bases long. This is only one strand of...

    pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...

  • Which of the following statements about Polymerase Chain Reactions is wrong? a. DNA is briefly heated...

    Which of the following statements about Polymerase Chain Reactions is wrong? a. DNA is briefly heated to break the hydrogen bonds holding two strands together. b. Primers hybridize to sequences at opposite ends of the target sequence on the same strand.   c. DNA is cooled to allow primers to form hydrogen bonds with the ends of the target sequence. d. The three steps of PCR are denaturation, annealing, and extension. e. PCR produces specific DNA fragments for cloning. f. Taq...

  • Please help with all questions. I provided all the information that I have. The sequence below...

    Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc   1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...

  • You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to...

    You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...

  • 1. Create the primers to amplify the gene of interest. 1. Below is almost the full...

    1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...

  • CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below...

    CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below to amplify the target region highlighter in pink (which could be an important gene such as insulin that you want to make many copies of). At this point, the double-stranded DNA has been heated so that the strands are now in a single-strand formation. Be sure to pay attention to the DNA sequence and the 5' 3'ends of the primers. 5' GG CCA A...

  • Order the steps in RT-PCR: 1. Add one primer complementary to the 3' end of the...

    Order the steps in RT-PCR: 1. Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+. Incubate the reaction appropriately. 2. Degrade the RNA strand with base, leaving just the cDNA. 3. cDNA is produced, which is single-stranded and complementary to the RNA of interest. 4. Double-stranded DNA for the region of interest is produced. 5. Add two primers (one forward and one reverse)...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT