Question

Which of the following statements about Polymerase Chain Reactions is wrong? a. DNA is briefly heated...

  1. Which of the following statements about Polymerase Chain Reactions is wrong?

    a.

    DNA is briefly heated to break the hydrogen bonds holding two strands together.

    b.

    Primers hybridize to sequences at opposite ends of the target sequence on the same strand.  

    c.

    DNA is cooled to allow primers to form hydrogen bonds with the ends of the target sequence.

    d.

    The three steps of PCR are denaturation, annealing, and extension.

    e.

    PCR produces specific DNA fragments for cloning.

    f.

    Taq polymerase adds nucleotides to the 3’ end of each primer.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

b.) Primers hybridize to sequence at opposite ends of the target sequence on the same strand.

Which is wrong. Because the one primer (Reverse primer) attaches to the top strand or 5' -3' of DNA while the second primer (Forward primer) attaches to the bottom strand or 3' -5' of the DNA. And these primers work simultaneously during the annealing process.

Other than this all the points described are true about PCR technique.

Add a comment
Know the answer?
Add Answer to:
Which of the following statements about Polymerase Chain Reactions is wrong? a. DNA is briefly heated...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • Which of the following statements about DNA replication is FALSE? Primase synthesizes the primers. DNA polymerase...

    Which of the following statements about DNA replication is FALSE? Primase synthesizes the primers. DNA polymerase is required to add new nucleotides to the growing ends of the DNA strands. DNA ligase joins the small DNA fragments of the lagging strand. Only one strand of the parent DNA serves as a template for a newly synthesized complementary strand.

  • THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template...

    THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template Temperature is lowered After one round of PCR the number of double-stranded DNA molecules is doubled. TGG TCACTTTGGCAAIAGAATT Heat-stable DNA polymerase adds nucleotides to the 3' end of the primer Primer 1 Primer 2 Heated to 72°C 5 TGCCTGGCCCCATCACTTTGGCAA AGAATTC 5

  • Match each step in a PCR cycle to its description. Unwind DNA to expose single strands...

    Match each step in a PCR cycle to its description. Unwind DNA to expose single strands A. Extension Temperature drop that allows primers to hybridize with the template B. Heat based denaturation Temperature increase that enables Taq to become maximally active C. Annealing

  • This PCR step is called annealing. The annealing step follows the denaturation step: it is usually...

    This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...

  • help please Put the following steps to the Polymerase Chain Reaction in correc order 1st Tube...

    help please Put the following steps to the Polymerase Chain Reaction in correc order 1st Tube is heated to about 95 der Tube is cooled to 70 degrees Tag Polymerase reads the pare [Choose Tag Polym Tag Polymerase reads the parent DNA and attaches the correct nucleotides 5th Choose Hydrogen bonds between the two strands durature Whicco Tube is heated to about 95 degree Celcius 6th Choose The process starts with a segment of the DNA of Interest being added...

  • Can someone help me figure out this concept map of Polymerase Chain Reaction. Microbiology Polymerase Chain...

    Can someone help me figure out this concept map of Polymerase Chain Reaction. Microbiology Polymerase Chain Reaction Match the terms on the right to the correct box below Polymerase chain reaction which are amplifies Specific sequences of DNA involves the following three steps facilitated by use of Cooling to -65°C Denaturation Extension Primers Priming Raising temperature to -72 Raising temperature to -910 Repeated in multiple cycles Taq polymerase Target DNA Target DNA Thermocycler accomplished by accomplished by accomplished by separates...

  • RNA differs from DNA in that it: all of the above contains ribose sugar contains uracil...

    RNA differs from DNA in that it: all of the above contains ribose sugar contains uracil is usually found as a single-stranded molecule in cells Question 21 pts The correct order of steps in a PCR cycle is: Extension, denaturation, annealing Annealing, extension, denaturation Annealing, denaturation, extension Denaturation, annealing, extension The goal of the polymerase chain reaction (PCR) is to: Amplify a small amount of DNA sequence Cleave DNA molecules Digest bacterial plasmids Sequence DNA Which of the following is...

  • Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)?...

    Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)? Question 16 options: A) Nucleoside triphosphates that serve as the source of the nucleotides A, T, C, and G needed in the synthesis of the new strands of DNA B) A restriction endonuclease enzyme that cleaves DNA at specific locations C) The segment of DNA that must be copied D) A DNA polymerase enzyme that will catalyze the synthesis of a complementary strand of...

  • Which of the following statements about eukaryotic DNA replication is false? A) DNA polymerase can add...

    Which of the following statements about eukaryotic DNA replication is false? A) DNA polymerase can add new nucleotides to either free 3'- or 5'-end B) RNA primers must be removed and rejected by the deoxynucleotides C) RNA primers must be laid down during DNA replication for synthesis of new DNA that starts at the 3'-OH of the primer ends D) Elongation of the DNA strand during replication requires primers with free 3'OH end E) The very end of the chromosome...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT