Question

You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Forward primer - 5' CCTCGAGTCAA 3'

Reverse primer - 5' CGCGCACATCAG 3'

Please do like amd comment if you have any query

Add a comment
Know the answer?
Add Answer to:
You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • DNA is double stranded, but only one strand is used as a template for transcription. How...

    DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...

  • Below is a sequence of double-stranded DNA that will be used as a template in the...

    Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below. Template DNA: 5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3' 3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5' If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...

    S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...

  • Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence...

    Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below. 5'-CCACTAGGGAGCTACGTAGGCACGGCATTACACGGATAGGCATTAACG-3' 3'-GGTGATCCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGTAATTGC-5' Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below 5'-CCACTAGGGAGCTACGTAGGCACGGCATTACACGGATAGGCATTAACG-3 3'-GGTGATCCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGTAATTGC-5 5'-CCACTAG-3'; 5'-CGTTAAT-3' 5'-GGTGATC-3'; 5'-GCAATTA-3' 5'-GATCACC-3':5'-CGTTAAT-3' 5'-CCACTAG-3';5'-GCAATTA-3' 5'-GGTGATC-3';5'-CGTTAAT-3'

  • pls help The DNA sequence below is 300 bases long. This is only one strand of...

    pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...

  • Please help with all questions. I provided all the information that I have. The sequence below...

    Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc   1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...

  • In a long double-stranded DNA molecule containing the genetic information for many genes, the template strand...

    In a long double-stranded DNA molecule containing the genetic information for many genes, the template strand for one gene may be the nontemplate strand for another gene. true or false

  • Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence...

    Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below.   5'-GGTGATCGGAGCTACGTAGGCACGGCATTACACGGATAGGCTAATTGC-3'   3'-CCACTAGCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGATTAACG-5' 5'-CCACTAG-3' ; 5'-GCAATTA-3' 5'-GATCACC-3' ; 5'-CGTTAAT-3'    5'-GGTGATC-3' ; 5'-GCAATTA-3' 5'-CCACTAG-3' ; 5'-CGTTAAT-3' 5'-GGTGATC-3' ; 5'-CGTTAAT-3'

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT