Question

The following is a fragment of double stranded DNA . The bottom strand is the template...

The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR

TTGGCAATGTGATCCCTTGTGCGGTACCACT

AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand)

The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis
RNA transcript compares to the non-template strand by being exactly identical

The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHTto LEFT.

a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below; be sure to include the apostrophe)
- A A C C G T T A C A C T A G G G A A C A C G C C A T G G T G A -

answer:?

b) In the text box below, write out the sequence and orientation of the RNA that is transcribed from this template. Identify the 5' and 3' ends, and start with the 5' end. (Format your answer exactly as follows: 5'-xxxxx.........xxxxxx-3' Be sure to include the apostrophes and the dashes before and after the actual sequence; NO SPACES).

answer:?

c) Now, use the genetic code to determine the amino acid sequence encoded by this mRNA. Counting from the N-terminus, amino acid #3 is , and amino acid # 5 is (Enter the three-letter abbreviation for each amino acid

answer:?
0 0
Add a comment Improve this question Transcribed image text
Answer #1

5' TTGGCAATGTGATCCCTTGTGCGGTACCACT 3' (coding/sense strand)

3' AACCGTTACACTAGGGAACACGCCATGGTGA 5' (Template strand)

The sequence of the transcript is as follows

5' UUGGCAAUGUGAUCCCUUGUGCGGUACCACU 3'

Leader

AUG- Met

UCC- Ser

This mRNA cannot be traslated into a peptide because the second codon is a ermination codon (UGA)

Add a comment
Know the answer?
Add Answer to:
The following is a fragment of double stranded DNA . The bottom strand is the template...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...

    The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...

  • DNA is double stranded, but only one strand is used as a template for transcription. How...

    DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...

  • PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...

    PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the answers below. (Select more than 1 answer) The coding strand is the first strand running from 5' to 3'. The coding strand is the second strand running from 3' to 5'. The template strand is the second strand running from 3' to 5'. The template strand is the first strand running from 5' to 3'. 2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • 1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...

    1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?

  • If the template strand for replication (the DNA strand that the DNA polymerase binds to and...

    If the template strand for replication (the DNA strand that the DNA polymerase binds to and "reads") has the sequence 5'-AGGCTTCGCTCCCG-3' then the complementary strand synthesized by the DNA polymerase would be what ?

  • Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule...

    Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...

  • hi please help. im having trouble with transcribing the given dna fragment! 1. A double stranded...

    hi please help. im having trouble with transcribing the given dna fragment! 1. A double stranded DNA has the following sequence: +1 5' GGCGGCGGCTGCCTATGCTGGCTTCAGCGTAGGCGTAC 3' coding strand TIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 3' CCGCCGCCGACGGATACGACCGAAGTCGCATCCGCATG 5' A UUU UAUTY ser UCO Stog Transcribe the given DNA fragment (5-GGC GGA UGC CUC GGC UGG CUU AAG CGG AC 5'UTR (highlight in green) Second Letter с 3' UTR (highlight in blue Start Codon (highlight in yellow) VUC ) Stop Codon (highlight in red) Open reading frame (enter...

  • 6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA...

    6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA TCA TCC CAA TAG AT Assume that RNA polymerase proceeds along this template from left to right. a) Which end of the DNA template is the 5' end and which end is 3'? b) What is the sequence of the complimentary DNA strand? c) Give the sequence and label the 5' and 3' ends of the mRNA copied from this template.

  • The sequence below represents the first section of the template strand of DNA of a structural...

    The sequence below represents the first section of the template strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written 3 GTAACTĀTAATTACGCGTATAATGAT 5 What would be the nucleotides that form the promoter? What would be the 5'UTR sequence? What would be the sequence...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT