Question

6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA...

6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA TCA TCC CAA TAG AT Assume that RNA polymerase proceeds along this template from left to right.

a) Which end of the DNA template is the 5' end and which end is 3'?

b) What is the sequence of the complimentary DNA strand?

c) Give the sequence and label the 5' and 3' ends of the mRNA copied from this template.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

dear student to solve this question you should know that

During transcription,theRNA polymerase read the DNA template strand from 3 to 5 direction but mrna is formed in 5 to 3 direction.

a.since the dna template strand is read grom 3 to 5 direction ..so the left side will be 3end and right will be 5 end .

b.sequence of complimentary dna strand adinine is replaced by thymine or vise versa and cytosine by guanine or vise versa.

it will be

3-TAA CGG TCT AGT AGG GTT ATC TA-5

c.we disscussed above that mrna is formed in 5 to 3 direction.looking to contemplary dna strand in partr b ..and makin mrna throgh transcription. in formation of mrna adenine will be replaced by uracil.

5-AUU GCC AGA UCA UCC CAA UAG AU-3

HOPE YOU GET ..ANY KIND OF FEEDBACK IS WELCOMED

Add a comment
Know the answer?
Add Answer to:
6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts)            ...

    5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts)             ATTGCCAGATCATCCCAATAGAT Label the 5’ and 3’ ends of the DNA template. (1 pt) b) Give the sequence and label the 5’ and 3’ ends of the RNA transcribed from this template. (2 pts)

  • is this transcribe correctly ? please explain DNA Template Strand Sequence: TAA ACT CGG TAC ATT...

    is this transcribe correctly ? please explain DNA Template Strand Sequence: TAA ACT CGG TAC ATT CTG GCT TAG CAC TAATTA CCC ATC Complementary mRNA Sequence: AUU AGA GCC AUG UAA GAC AUC GUG AUU AAU GGG UAG

  • The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT...

    The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...

    The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to...

    Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...

  • i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this...

    i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.

  • 6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...

    6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...

  • 11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT |...

    11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT