5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3'
3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5'
a) Which strand of DNA shown, the top or the bottom, is the template strand?
b) What is the sequence of the mRNA produced from this gene? Write the sequence and label the 5’ and 3’ ends.
c) What is the sequence of the polypeptide produced from the mRNA in (b)? Write the sequence and label the N and C termini.
d) If a point mutation changed the bold G/C (top/bottom) base pair was changed to an C/G (top/bottom) base pair instead, what would be the new sequence of the mRNA? What would be the sequence of the protein?
Given DNA sequence:
5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3'
3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5'
a) The top strand is the template strand.
b) The sequence of the mRNA produced from this gene is:
5' GUAUAAAUCCCUAUGUUGACUUCAAAGGGCCCAUGGAAGGGCUGAUUCCUAAGA 3'
c) The sequence of the polypeptide produced from the mRNA:
N-Val-STOP-Ile-Pro-Met-Leu-Thr-Ser-Lys-Gly-Pro-Trp-Lys-Gly-STOP-Phe-Leu-Arg-C

d) If a point mutation changed the bold G/C (top/bottom) base pair was changed to C/G (top/bottom) base pair instead, the new sequence of the DNA will be:
5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGCAAGGGCTGATTCCTAAGA 3'
3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACGTTCCCGACTAAGGATTCT 5'
The sequence of the mRNA will be:
5' GUAUAAAUCCCUAUGUUGACUUCAAAGGGCCCAUGCAAGGGCUGAUUCCUAAGA 3'
The sequence of the polypeptide or protein produced from the mRNA:
N-Val-STOP-Ile-Pro-Met-Leu-Thr-Ser-Lys-Gly-Pro-Cys-Lys-Gly-STOP-Phe-Leu-Arg-C

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
11. Using the DNA sequence below and the codon table on the projector, perform the following: a. Produce the correct MRNA transcript. On the DNA sequence below, the top strand is the template strand, and transcription begins immediately following the promoter sequence and ends at the end of the DNA sequence. (5 points) b. Produce the correct polypeptide sequence. (5 points) Prometer GTCACGGGTACCCTGTGTTAAGGCATCGTATGATACATACCACTATGTACCATGGACACAATTCCGTAGCATAAGCATGACCC CAGTGCCCATGGGACACAATTCCGTAGCATACTATGTATGGTGATACATGGTACCTGTGTTAAGGCATCGTATTCGTACTGGG
11. Using the DNA sequence below and the codon table on the projector, perform the following:...
Part C
this is for Genetics
UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...
Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
All are the same diagrams
Consider the following double-stranded region of a gene: Strand 17 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2 3-TTAGCATACGCTTCGGGAATTGA - 5 The number of mRNA codons in the corresponding transcript is: A 1 3.4 OC5 E Cannot be determined Consider the double-stranded DNA sequence of a gene below: Strand 1: 5'-AATCGTATGCGAAGCCCTTAACT-3' Strand 2. 3'-TTAGCATACGCTTCGGGAATTGA-5 The number of amino acids in the corresponding peptide is: OOOOO du . w Consider the following double-stranded region of a gene below: Strand 17...
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
Part A
Which model shows the correct polarity of double-stranded
DNA?
Which model shows the correct polarity of double-stranded
DNA?
Part B
Which model shows the correct polarity between mRNA and the DNA
template during transcription?
Which model shows the correct polarity between mRNA and the DNA
template during transcription?
Part C
Which model shows the correct polarity between mRNA and tRNA
during translation?
Which model shows the correct polarity between mRNA and tRNA
during translation?
Part D
Interpret this...