Question

Part A

Which model shows the correct polarity of double-stranded DNA?

Which model shows the correct polarity of double-stranded DNA?

A G A C T G GT A CCA T CT 3
A double-stranded DNA polarity model consisting of upper and lower horizontal red lines between which lie upper and lower rows of black letters, and a middle row of vertical black lines connecting the letters of each row. The left side of the top red line is labeled “three-prime", and the right side has an arrowhead labeled “five-prime”. The top row of letters reads: “A, G, A, C, T, G, G, T.” The bottom row of letters reads: “T, C, T, G, A, C, C, A.” The left side of the bottom red line is labeled “three-prime”, and the right side has an arrowhead labeled “five-prime”.
A double-stranded DNA polarity model consisting of upper and lower horizontal red lines between which lie upper and lower rows of black letters, and a middle row of vertical black lines connecting the letters of each row. The top red line has an arrowhead on its left side labeled “three-prime”, and the right side is labeled “five-prime”. The top row of letters reads: “A, G, A, C, T, G, G, T.” The bottom row of letters reads: “T, C, T, G, A, C, C, A.” The left side of the bottom red line is labeled “five-prime”, and the right side has an arrowhead labeled “three-prime”.
A double-stranded DNA polarity model consisting of upper and lower horizontal red lines between which lie upper and lower rows of black letters, and a middle row of vertical black lines connecting the letters of each row. The top red line has an arrowhead on its left side labeled “five-prime", and the right side is labeled “three-prime”. The top row of letters reads: “A, G, A, C, T, G, G, T.” The bottom row of letters reads: “T, C, T, G, A, C, C, A.” The left side of the bottom red line is labeled “five-prime”, and the right side has an arrowhead labeled “three-prime”.

Part B

Which model shows the correct polarity between mRNA and the DNA template during transcription?

Which model shows the correct polarity between mRNA and the DNA template during transcription?

A horizontal model showing polarity between mRNA and the DNA template during transcription. The top row consists of a shorter orange line with an arrowhead on the left side labeled "three-prime", and the label "five-prime" on its right side. Directly under the orange line are the letters "A, G, A, C, U." Next is a row of five short vertical lines centered beneath each letter under the orange line, and over the first five letters of the next line consisting of "T, C, T, G, A, C, C, A." The bottom row consists of a long red line with an arrowhead on its left side labeled "three-prime", and the label "five-prime" on its right side."
A horizontal model showing polarity between mRNA and the DNA template during transcription. The top row consists of a shorter orange line with an arrowhead on the left side labeled "five-prime", and the label "three-prime" on its right side. Directly under the orange line are the letters "A, G, A, C, U." Next is a row of five short vertical lines centered beneath each letter under the orange line, and over the first five letters of the next line consisting of "T, C, T, G, A, C, C, A." The bottom row consists of a long red line with an arrowhead on its left side labeled "five-prime", and the label "three-prime" on its right side."
A horizontal model showing polarity between mRNA and the DNA template during transcription. The top row consists of a shorter orange line labeled "three-prime" on the left, with an arrowhead on the right labeled "five-prime". Directly under the orange line are the letters "A, G, A, C, U." Next is a row of five short vertical lines centered beneath each letter under the orange line, and over the first five letters of the next line consisting of "T, C, T, G, A, C, C, A." The bottom row consists of a long red line with an arrowhead on its left side labeled "three-prime", and the label "five-prime" on its right side."
A horizontal model showing polarity between mRNA and the DNA template during transcription. The top row consists of a shorter orange line labeled "five-prime" on the left side, with an arrowhead on the right labeled "three-prime". Directly under the orange line are the letters "A, G, A, C, U." Next is a row of five short vertical lines centered beneath each letter under the orange line, and over the first five letters of the next line consisting of "T, C, T, G, A, C, C, A." The bottom row consists of a long red line with an arrowhead on its left side labeled "three-prime", and the label "five-prime" on its right side."

Part C

Which model shows the correct polarity between mRNA and tRNA during translation?

Which model shows the correct polarity between mRNA and tRNA during translation?

A model showing polarity between mRNA and tRNA during translation. A symmetrical, linear cloverleaf-like configuration is drawn. Its top left point is labeled "three-prime". Its top right point ends with an arrowhead labeled “five-prime”. There are three thin vertical lines at the bottom of the cloverleaf-like configuration that connect to an orange left facing arrow. The arrow’s left side is labeled “three-prime” and the right side is labeled “five-prime”.
A model showing polarity between mRNA and tRNA during translation. A symmetrical, linear cloverleaf-like configuration is drawn. Its top left point is labeled "five-prime". Its top right point ends with an arrowhead labeled “three-prime”. There are three thin vertical lines at the bottom of the cloverleaf-like configuration that connect to an orange left facing arrow. The arrow’s left side is labeled “five-prime” and the right side is labeled “three-prime”.
A model showing polarity between mRNA and tRNA during translation. A symmetrical, linear cloverleaf-like configuration is drawn. Its top left point is labeled "three-prime". Its top right point ends with an arrowhead labeled “five-prime”. There are three thin vertical lines at the bottom of the cloverleaf-like configuration that connect to an orange right facing arrow. The arrow’s left side is labeled “three-prime” and the right side is labeled “five-prime”.
A model showing polarity between mRNA and tRNA during translation. A symmetrical, linear cloverleaf-like configuration is drawn. Its top left point is labeled "five-prime". Its top right point ends with an arrowhead labeled “three-prime”. There are three thin vertical lines at the bottom of the cloverleaf-like configuration that connect to an orange left facing arrow. The arrow’s left side is labeled “three-prime” and the right side is labeled “five-prime”.

Part D

Interpret this model of transcription.A transcription model that has an upper horizontal red line with a long, central convex-curve, with an arrowhead on the left side labeled "three-prime", and the label "five-prime", on the right side. There is a lower horizontal red line with a long, central concave-curve, with the label "five-prime" on its left side, and an arrowhead on its right side labeled "three-prime". An orange concave-curved line sits just above the concave-curve of the lower red line labeled "five-prime" on its left side, and has an arrowhead on its right side labeled "three-prime".

Drag "True" or "False" to the end of each statement.

True

False

The 5' labels refer to the end of the strand with a nitrogenous base.

The model correctly shows an arrowhead on the 3' ends of the strands.

The 3' labels refer to the end of the strand with a phosphate group.

Hydrogen bonds between the orange and red strands are not shown but are implied by the model.

The red lines represent DNA.

The orange line represents RNA.

The model shows the correct polarity between the orange and red strands.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

orl OH 3 oH und and3 aH endPART-A TCT ACC (aer-C False True FalSe rLuA FalseNole - tin en idirck NA Ase a o ar addid ubbl e to codings

Add a comment
Know the answer?
Add Answer to:
Part A Which model shows the correct polarity of double-stranded DNA? Which model shows the correct...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 5/7 are correct I am so confused about which ones are incorrect Interpret this model of...

    5/7 are correct I am so confused about which ones are incorrect Interpret this model of transcription. Drag "True" or "False" to the end of each statement. Hydrogen bonds between the orange and red strands are not shown but are implied by the model. True The model shows the correct polarity between the orange and red strands. True The red lines represent DNA. True The 5' labels refer to the end of the strand with a nitrogenous base. False The...

  • Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to...

    Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...

  • 6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...

    6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...

  • 1. Which of the following statements is FALSE? Helicase activity 'unwinds DNA making the double-stranded molecule...

    1. Which of the following statements is FALSE? Helicase activity 'unwinds DNA making the double-stranded molecule into single strands. b. The leading strand of DNA is started by an RNA primer The lagging strand of DNA is synthesized as "Okazaki fragments", cach with its own RNA primer. DNA replication proceeds in both directions around the bacterial chromosome. DNA polymerase synthesives new DNA in one direction (3 to 5) only. 2. Which of the following would be found in eukaryotes? a....

  • 20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded...

    20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...

  • DNA is double stranded, but only one strand is used as a template for transcription. How...

    DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...

  • The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...

    The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • The following double stranded segment of DNA is part of a protein coding gene. The segments...

    The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:

  • BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are...

    BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are the differences between replication and transcription? 4. What is translation? 5. What is the role of mRNA, TRNA, and tRNA during translation? 6. What is the function of ribosomes? 7. Which enzyme catalyzes the transcription? 8. A DNA molecule has two strands (double helix) - how many of its strands are/is replication and transcription? 9. What is the difference between transcription and translation occurring...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT