Answer 6 is correct.

Please rate high.
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...
Match the following choices to the questions below. UUU catalyzes translocation of the ribosome involved in transcription associated with the binding of mRNA in the ribosome binds to Shine-Dalgarno sequence involved in replication contains information in the form of anticodons catalyzes the formation of amino acid-AMP AUG UAG binds to pribnow box catalyzes formation of peptide bonds catalyzes disassembly of the translation complex associated with the binding of tRNA in the ribosome catalyzes disassembly of the transcription complex start codon...
Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of DNA, mRNA, TRNA and/or polypeptide (AA : amino acids). Remember A codon chart can only be used for decoding a strand of mRNA Codon Chart a THrd DNA: TAC GCG CCT AGG 6GG TGG mRNA: DNA: TTC GAT TAG ATG CCG AAG mRNA: tRNA: - - DNA: mRNA:
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Please use the drop down menu of answer choices to answer all
questions. Reference both picturea for all possible answer choices.
Thanks!
1. At this step in the process of translation the ribosome assemble around the mRNA 2 At this step in translation the tRNA takes amino acids to the ribosomes attached to mRNA_to build a polypeptide chain 3. At this step in translation the ribosome releases the polypeptide chain 4. True/False in prokaryotes translation takes place in the cytoplasm...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a stop codon. A release factor binds and causes the release of the new polypeptide, along with the mRNA. The ribosome dissociates. v Acharged tRNA with a matching anticodon binds the mRNA codon in the A site. ✓ The ribosome moves exactly 3 nucleotides toward the 3* end of the mRNA. The small ribosomal subunit uses rRNA to bind to the Kozak sequence, which places...
Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' What effect would the following DNA mutation have on the polypeptide synthesized from the gene? DNA template: 3' - GGGTTCGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAAGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' There will be no effect because the codon still calls for the same amino acid. The polypeptide's synthesis will stop too soon because a stop codon has been introduced too early in the sequence. A...