
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand.
Left to Right Right to Left
Lagging to Leading A site to P site
ii) Given the information in 6 i, write the sequence of the mRNA that is transcribed from this region. Label the 5' and 3' end of this molecule.
iii) This portion of the mRNA contains the region where release factor binds. What is the role of release factor during translation?
iv) Given the information in 6 ii, what protein sequence is encoded by this portion of the mRNA? Show your work for full credit. Be sure to label the N and C terminus of the protein sequence.
v) If a tRNA has an anticodon that is 5'-CCA-3', write the codon below. Label the 5' and 3'ends for full credit.
vi) What amino acid would the tRNA in 6 v be bringing to the ribosome? Write out the full name of the amino acid for full credit.
i) The RNA polymerase will move along Left to right in the template strand, i.e from the 3' end to the 5' end. The reason behind this is the fact that Transcription will always occur towards the same direction in which the coding strand moves. Since RNA polymerase cannot bind to the coding strand (obviously due to misalignment of 3' and 5' ends), hence in order to replicate the coding strand the template strand needs to be transcribed in 3' to 5' direction only for getting the exact replica of coding strand.
ii) The sequence of mRNA will be as follows -
5'-ACAUUGCAGGGAUGCAUAAAUCU-3'
Reason : Obviously the mRNA sequence will resemble to that of coding strand, except T being replaced with U. Nothing to elaborate in this. mRNA is the replica of Coding strand.
iii) Release factor is also called the stop codon. It codes for the specific protein which signals or indicates the termination for the entire process of translation. The stop codons (UGA, UAA, UAG) enter the ribosomal subunit and trigger the abrupt stoppage of the Translation process. Presence of stop codons in the mRNA sequence will signify that the mRNA needs to be translated upto here only.
iv) The protein sequence will be as follows :
N---TLQGCIN---C
Reason: We will firstly make a sequential triad (group of 3) of all the nucleotides, called Codons. The codons and their respective amino acids will be determined by comparing them to the corresponding entry in the table mentioned in the question. The results will be as follows --
T-ACA
L-UUG
Q-CAG
G-GGA
C-UGC
I-AUA
N-AAU
v) The codon will be 5'--UGG--3'
Reason: The anticodon on tRNA has exactly reverse and complementary sequence of the codon, since it runs from the opposite direction. To get the codon from tRNA anticodon, we need to reverse the sequence and then write the complementary nucleotide. For CCA, the complementary will be GGU, and its reverse will be UGG.
vi) Since the codon sequence is UGG, so it will bring W amino acid to the ribosome (refer to the table given in question). Here, W stands for Tryptophan (Trp).
Please do give a thumbs up and an upvote if this answer really helped you :-)
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
2. The following sequence is a wild-type gene that encodes a tRNA-his molecule that recognizes the codon 5- CAU-3' on all mRNAs in the bacterial cell. The sequence given is from the point where transcription starts (called "+1") to the point where transcription ends (called the "terminator"). 5'-CCCGTTGCTCAGATCTGGATATCCTTCCTGCATAGAATCGCTTGCTGAAGCTGATACGCGCAACGGT-3' 3'-GGGCAACGAGTCTAGACCTATAGGAAGGACGTATCTTAGCGAACGACTTCGACTATGCGCGTTGCCA-5' a. Which strand (the upper or the lower) is used as the template in transcription? UNDERLINE THE CORRECT CHOICE b. Write out the amino acid sequence the protein, if any, that...
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...