Question

I have my own answers, i just want to check my work, thanks!Given the DNA sequence below: 3-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5 (Coding strand) Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5 and 3 ends in the new strand. Transcribe the template strand to an mRNA sequence. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. Write the amino acid sequence of the translation product starting from the start codon, until you encounter a stop codon. Enclose the stop codon with a box. During DNA replication, a mutation occurred and GTC in the coding sequence (indicated in red color) got deleted from the gene. Write the corresponding DNA template sequence and transcribe the mutated mRNA sequence. Give the amino acid sequence of the resulting mutated protein. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA. 1. 2. 3. 4. 5. 6. Note: Late and email submission wont be accepted. No reference section is needed for this homework.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans 1. Template strand 3’ -ACGCTAATGTGAACCTACATGGACCGGCATTCCGCGAAGTATAGAAGGACG-5’

               Coding strand   5’ -TGCGATTACACTTGGATGTACCTGGCCGTAAGGCGCTTCAATATCTTCCTGC-3’

Ans 2. m RNA sequence 5’-UGCGAUUACACUUGGAUGUACCUGGCCGUAAGGCGCUUCAUAUCUUCCUGC-3’

Ans 4. Amino acid sequence (Met-Tyr-Leu-Ala-Val-Arg-Arg-Phe-lle-Ser-Ser-Cys)

Ans 5. Template strand 3’ -ACGCTAATGTGAACCTACATGCGGCATTCCGCGAAGTATAGAAGGACG-5’

                Coding strand   5’ -TGCGATTACACTTGGATGTACGCCGTAAGGCGCTTCAATATCTTCCTGC-3’

Mutated m RNA sequence 5’ -UGCGAUUACACUUGGAUGUACGCCGUAAGGCGCUUCAUAUCUUCCUGC-3’

Amino acid sequences (Met-Tyr-Ala-Val-Arg-Arg-Phe-lle-Ser-Ser-Cys)

Ans 6. Template strand 3’ -ACGCTTATGTGAACCTACATGGACCGGCATTCCGCGAAGTATAGAAGGACG-5’

                Coding strand   5’ -TGCGAATACACTTGGATGTACCTGGCCGTAAGGCGCTTCAATATCTTCCTGC-3’

m RNA sequence 5’-UGCGAAUACACUUGGAUGUACCUGGCCGUAAGGCGCUUCAUAUCUUCCUGC-3’

amino acid sequence – as well same as ans no. 5

note- there is no stop codon in this

Add a comment
Know the answer?
Add Answer to:
I have my own answers, i just want to check my work, thanks! Given the DNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was...

    Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.

  • need help with part c Scie Clas Class DNA to Proteins (Gene Expression) You are given...

    need help with part c Scie Clas Class DNA to Proteins (Gene Expression) You are given the DNA template: 3' A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A-A- T-T-C-TS' Complete the following exercise: A. DNA replication. Write the sequence of complementary bases produced if the above DNA template undergoes replication. 3'A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A- A-T-T-C-T5' 3 T-T-A-T-C-A-T-G-C-G-C-T-C-A-G-C-A-C-t-A-C-T-T- T-A-A-G-AS' B. Transcription. Using the original DNA template, construct the sequence of nucleotide bases for the transcribed RNA strand. 3'AAT-AGT -ACG-CGA-GTC-GTG -ATG-AAA -TTC-T 3'UVA - UCA-UGC-GCU-CAG-CAC-AC - VUU-AAG-A5 C. Translation. Using the mRNA...

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • Question 16: The following shows the same segment of DNA that was shown above in Question...

    Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...

  • I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....

    I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • How DNA Is Copied 4. What does it mean that the two strands of DNA are...

    How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

  • 7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA...

    7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...

  • The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...

    The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...

  • 5. Hemoglobin is the protein found in red blood cells that transports oxygen from your lungs...

    5. Hemoglobin is the protein found in red blood cells that transports oxygen from your lungs to your cells. Below is a segment of the DNA sequence that codes for a normal hemoglobin protein (the entire gene is much longer). Using the DNA sequence provided, transcribe the sequence into mRNA. Use the bottom strand as the coding strand. 5' ACTGCCCATGGTGCAC CIGACTCCTGAGGAG 3' 3' TGAC GG GIACCA CGT GGA CIGAG GACTCCTC 5 6. For hemoglobin, translate the mRNA strand from step...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT