Question

7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3 Suppose that an mRNA is transcribed from the com
0 0
Add a comment Improve this question Transcribed image text
Answer #1

starting codon 5 - UAG UAU GCU AAU UUGA - 3 → Sequence of M-RNA MUTATION 11 A deletion of the fourth Coding nucleotide (acytAGTATGCT Agaat ATTTGA-31 3- ATCATA CGAT etta TAAA CT-5 Non Template strand Template strand TRANSCRIPTION The sequence of mRN

Add a comment
Know the answer?
Add Answer to:
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...

    One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...

  • One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’

    One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...

  • The sequence below represents a middle section of the template strand of DNA of a structural...

    The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed...

  • DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...

    DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...

  • Answer please? The sequence below represents a middle section of the template strand of DNA of...

    Answer please? The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • 1) Using the bacterial DNA sequence that the instructor gave you:

    1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...

  • 1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning...

    1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning properly? photoreactivation repair base excision repair SOS repair double-strand break repair nucleotide excision repair 2. In bacteria and eukaryotes, a mutation is when ________. In bacteria and eukaryotes, a mutation is when ________. A.the nucleotide sequence in an mRNA molecule is directly changed B.the nucleotide sequence in a DNA molecule is directly changed C.the amino acid sequence in a protein molecule is directly changed...

  • please help ! What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check...

    please help ! What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check Answer Use the codon table to answer the following questions: THE CODON TABLE SECOND POSITION FIRST POSITION THIRD POSITION 0000000000000000 What would be the second amino acid produced by the DNA strand TACCGA GTCACG (Hint: use the mRNA strand you already coded) Check Answer Value: 1 What would be the third amino acid produced by the DNA strand: TACCGAGTCACG (Hint: use the mRNA strand...

  • Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into...

    Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’                                                                                                                                                                           5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT