


(1) The nucleotide adenine (A) always pairs with the nuecleotide thymine (T).
The nucleotide Guanine (G) always pairs with the nuecleotide cytosine (C).
(2) Thymine is a complementary base of adenine.
Cytosine is a complementary base of guanine.
Adenine is a complementary base of thymine.
Guanine is a complementary base of cytosine.
(3) The complementary strand of the given DNA strand is:
TCGACTGGATCGCCTGTT
(4) (i) The process of synthesizing mRNA strand is known as transcription.
(ii) In mRNA, the complementary base to adenine is Uracil (U).
(iii) The mRNA strand that would be synthesized by the given DNA strand is:
UCGACUGGAUCGCCUGUU
(5) (i) Three nucleotides of an mRNA code for an amino acid.
(ii) The mRNA code that instructs the placement of a specific amino acid is known as a codon.
(iii) The codon for Tryptophan is UGG.
(iv) The codon for amino acid serine is UCA.
(v) Total number of amino acids encoded by mRNA in step 4(c) = 18/3 = 6.
(6) (i) The codon for amino acid methionine is AUG.
(Ii) The codon for amino acid leucine is CUU or CUC.
(iii) The codon CCC codes for the amino acid proline.
(iv) Valine is encoded by four codons.
(v) The codons that code for valine differ in their last nucleotide of the codon.
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise 8 to make the protein for which it codes. STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGGCAGAACC STEP 2 Draw the DNA strand separating down the middle (as in the beginning of DNA replication). STEP 3 Draw the free-floating RNA bases linking up with the top...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
please help!!
In-lab Activity on DNA, DNA Replication and Pro Directions: Complete the color key belowing the Key to colors Adenine - blue Replication and Protein Synthesis Name the DNA modelin class. then awer the questions about the mode ThymineONOMI Deoxyribose Oangcor Red 1. Using the nitrogen base letters to repre your color key and this sequence of colors for the sen blue-blue-orange-yellow-orange-yello Cytosine yellow Guanine - Green COLOR CHOICES Yellow Purple Red Green Orange u to represent nucleotides, wide...
Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated into amino acids. Complete the DNA-to-amino acid table for three consecutive codons with the appropriate nucleotides and amino acids using a codon table. Nucleotide and amino add options can be used multiple times or not at all.
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...