Question

The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. P
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Explanation:

  • The genetic information in the fragment of DNA or a gene, may be expressed by its ability to encode a specific RNA or protein.
  • The product thus generated typically “expresses” the genetic information of the gene. As described by the hypothesis of George Wells Beadle and Edward Lawrie Tatum, “One gene one enzyme”; the product of each genetic expression influences the activity of the cell.
  • Thus, the process of transcription occurs to produce mRNA and translation to produce protein is defined as the central dogma.
  • DNA - > mRNA - > Protein
  • 5’ to 3’ strand of DNA serves as coding strand.
  • 3’ to 5’ strand of DNA act as template strand.
  • RNA is synthesized by complementary base pairing with the template strand.
  • Thus, the RNA will have same sequence as coding strand (only T is replaced by U) and is oriented in 5’ to 3’ direction
  • Eukaryotic gene contain, regions of “expressed sequence” or exons, which code for proteins and non-coding or” intervening sequence” or introns.
  • The pre-RNA transcript requires splicing process, by which introns are removed, exons are joined to form mature RNA. The process of splicing is mediated by small nuclear ribonuclear proteins (snRNPs or SNURPS).

Answers:

Given template strand:

3' CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5'

Corresponding coding strand:

5' GTACCTGTCcattcttatgttgtgtcCAGCCGTACTGC 3’

Immature mRNA:

5' GUACCUGUCcauucuuauguugugucCAGCCGUACUGC 3’

mRNA with introns removed:

5' GUACCUGUCCAGCCGUACUGC 3’

Aminoacid:

VAL-PRO-VAL-GLN-PRO-TYR-CYS

Add a comment
Know the answer?
Add Answer to:
The sequence below represents a middle section of the template strand of DNA of a structural...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Answer please? The sequence below represents a middle section of the template strand of DNA of...

    Answer please? The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...

  • 0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand...

    0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3CATGGACAGgtaagaatacaacacagGTCGGCATGACG5 GUACCUGU cauuuuauguuguguCCAGCCGUACUGC What would be...

  • The sequence below represents the first section of the template strand of DNA of a structural...

    The sequence below represents the first section of the template strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written 3 GTAACTĀTAATTACGCGTATAATGAT 5 What would be the nucleotides that form the promoter? What would be the 5'UTR sequence? What would be the sequence...

  • please help with all 3 Incorrect Question 19 0/10 pts The sequence below represents the first...

    please help with all 3 Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...

  • Question 29 2 pts DNA coding strand DNA template strand - The sequence of the peptide...

    Question 29 2 pts DNA coding strand DNA template strand - The sequence of the peptide that would result from transcribing and translating the gene pictured would be Met-Arg-Leu. Tyr-Ala-Asn. no peptide would be made, the first codon means "stop." lle-Ser-Val. Tyr-Ser-Val.

  • Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence...

    Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence of the mRNA that would result from transcribing the gene pictured would be A. AUGCGAUUA B. AUUAGCGUA C. UACGCUAAU D. UAAUCGCAU E. ATGCGATTA 3. The sequence of the peptide that would result from transcribing and translating the gene pictured would be A. Tyr-Ala-aso B. Ile-Ser-Val. C. no peptide would be made, the first codon means "stop." D. Met-are-Leu. E. Tyr-Ser-Val.

  • If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A....

    If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...

  • 7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA...

    7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • 5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the...

    5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT