Answer:
1. Immature RNA transcribed from this gene
GUACCUGUCCAUUCUUAUGUUGUGUCCAGCCGUACUGC
2. Sequence removed from immature mRNA
CAUUCUUAUGUUGUGUC
3. Amino acid coded by the gene
VAL-PRO-VAL-GLN-PRO-TYR-CYS
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand...
Answer please?
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed...
The sequence below represents the first section of the template strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written 3 GTAACTĀTAATTACGCGTATAATGAT 5 What would be the nucleotides that form the promoter? What would be the 5'UTR sequence? What would be the sequence...
please help with all 3
Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...
Question 29 2 pts DNA coding strand DNA template strand - The sequence of the peptide that would result from transcribing and translating the gene pictured would be Met-Arg-Leu. Tyr-Ala-Asn. no peptide would be made, the first codon means "stop." lle-Ser-Val. Tyr-Ser-Val.
Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence of the mRNA that would result from transcribing the gene pictured would be A. AUGCGAUUA B. AUUAGCGUA C. UACGCUAAU D. UAAUCGCAU E. ATGCGATTA 3. The sequence of the peptide that would result from transcribing and translating the gene pictured would be A. Tyr-Ala-aso B. Ile-Ser-Val. C. no peptide would be made, the first codon means "stop." D. Met-are-Leu. E. Tyr-Ser-Val.
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template strand? 3' CATGTACGCATTGAGAACTCGC 5' Asp-His-Ala-Stop-Leu-Leu-Ser Met-Arg-Asn-Ser Met-Arg-Asn-Ser-Ala Met-Tyr-Ala-Leu-Arg-Thr-Arg Asp-His-Ala-Leu-Leu-Ser Asp-His-Ala His-Val-Arg-Ile-Glu-Asn-Ser Met-Arg-Asn-Ser-Stop-Ala Check the orientation of the strands. How do you know which reading frame to use?
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...