Question

Question 29 2 pts DNA coding strand DNA template strand - The sequence of the peptide that would result from transcribing and
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The sequence of peptide that would result from transcribing and translating the gene pictured would be Met-Arg-Leu because triplet codons on DNA template strand are TAC, GCT and AAT. After transcription, these codons on template strand would form mRNA molecule,which will have AUG, CGA and UUA. The translation of AUG, CGA and UUA codons on mRNA molecule would give rise to a Met-Arg-Leu peptide sequence. Met, Arg and Leu refer to Methionine, Arginine and Leucine.

In order to find out DNA template strand codons and mRNA codons for other amino acids mentioned in question, please refer to the table given below.

Amino Acid DNA template strand codons mRNA codons
Arginine GCA,GCG,GCT,GCC,TCC,TCT CGA, AGA, AGG, CGG, CGC, CGU
Leucine GAC, GAT, GAG,GAA, AAC,AAT CUA, CUG, CUU, CUC, UUG, UUA
Tyrosine ATG, ATA UAC, UAU
Alanine CGT, CGC, CGG,CGA GCA, GCG, GCC,GCU
Asparagine TTG,TTA AAC, AAU
Isoleucine TAG,TAT, TAA AUC, AUA, AUU
Serine TCA,TCG, AGC, AGT, AGG,AGA UCC,UCA,UCG,AGU,AGC,UCU
Valine CAT, CAG, CAA, CAC GUU,GUA,GUC,GUG

ATT, ACT and ATC are DNA template strand codons that mean stop.

DNA template strand is the strand of DNA that acts as template for transcription. Transcription is a process through which RNA molecules are synthesised by DNA-dependent RNA polymerase.  

Add a comment
Know the answer?
Add Answer to:
Question 29 2 pts DNA coding strand DNA template strand - The sequence of the peptide...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence...

    Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence of the mRNA that would result from transcribing the gene pictured would be A. AUGCGAUUA B. AUUAGCGUA C. UACGCUAAU D. UAAUCGCAU E. ATGCGATTA 3. The sequence of the peptide that would result from transcribing and translating the gene pictured would be A. Tyr-Ala-aso B. Ile-Ser-Val. C. no peptide would be made, the first codon means "stop." D. Met-are-Leu. E. Tyr-Ser-Val.

  • Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template...

    Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template strand? 3' CATGTACGCATTGAGAACTCGC 5' Asp-His-Ala-Stop-Leu-Leu-Ser Met-Arg-Asn-Ser Met-Arg-Asn-Ser-Ala Met-Tyr-Ala-Leu-Arg-Thr-Arg Asp-His-Ala-Leu-Leu-Ser Asp-His-Ala His-Val-Arg-Ile-Glu-Asn-Ser Met-Arg-Asn-Ser-Stop-Ala Check the orientation of the strands. How do you know which reading frame to use?

  • If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A....

    If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...

    What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...

  • For the following DNA strand, what is the amino acid chain that would result in the cell?

    For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro

  • clon 25 3 p Given the following DNA template, the sequence of the protein made is:...

    clon 25 3 p Given the following DNA template, the sequence of the protein made is: 5'-AGC TCG AAT TCG CTT CAT GCT AGC TAG-----(+1)-------(-10)-------- --(-35 Leu-Ala-Cys-Met-Lys-Arg-lle-Arg-Ala Asp-Arg-Ser-Tyr-Phe-Ala-Stop Met-Ala-Ser-Stop Met-Lys-Arg.lle-Arg Ala Ser-Ser Asp-Ser-Leu-His-Ala-Ser-Stop

  • Question 25 3 pts Given the following DNA template, the sequence of the protein made is:...

    Question 25 3 pts Given the following DNA template, the sequence of the protein made is: 5'-AGC TCG AAT TCG CTT CAT GCT AGC TAG------(+1)--------(-10) ----------(-35) Leu-Ala-Cys-Met-Lys-Arg.lle-Arg-Ala Asp-Arg-Ser-Tyr-Phe-Ala-Stop Met-Ala-Ser-Stop Met-Lys-Arg-lle Arg-Ala Ser-Ser-Asp-Ser-Leu-His-Alo Ser-Stop 3 pts Question 30 In a cancer genomes database, you find multiple mutations in the BMV gene in several types of cancers. The majority of these cancer-associated mutations are heterozygous (having also one wild type allele), and expression of these mutant versions of BMV in normal cells...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT