
Translation
process that is protein synthesis initiated by start Codon (i.e,
AUG) amino acids formed will be Methionine Arginine Isoleucine
Leucine Leucine
AUG codes for Methionine
CGC codes for Arginine
AUA codes for Isoleucine
UUA codes for Leucine
CUA codes for Leucine
The sequence below represents the first section of the template strand of DNA of a structural...
please help with all 3
Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed...
Answer please?
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3CATGGACAGgtaagaatacaacacagGTCGGCATGACG5 GUACCUGU cauuuuauguuguguCCAGCCGUACUGC What would be...
Question 29 2 pts DNA coding strand DNA template strand - The sequence of the peptide that would result from transcribing and translating the gene pictured would be Met-Arg-Leu. Tyr-Ala-Asn. no peptide would be made, the first codon means "stop." lle-Ser-Val. Tyr-Ser-Val.
Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence of the mRNA that would result from transcribing the gene pictured would be A. AUGCGAUUA B. AUUAGCGUA C. UACGCUAAU D. UAAUCGCAU E. ATGCGATTA 3. The sequence of the peptide that would result from transcribing and translating the gene pictured would be A. Tyr-Ala-aso B. Ile-Ser-Val. C. no peptide would be made, the first codon means "stop." D. Met-are-Leu. E. Tyr-Ser-Val.
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...