Question

4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleoti

0 0
Add a comment Improve this question Transcribed image text
Answer #1

mRNA: 5’-AUC UUC CAG AUC ACU GUC CUU CUA GCC AUG GAA AAU GAC GAA UUG UGA CUG CCC CTG C-3’

Amino acid sequence: NH3-Met-Glu-Asn-Asp-Glu-Leu-COOH

Add a comment
Know the answer?
Add Answer to:
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would:...

    This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would: Be transcribed Encode a primary transcript that would be fully processed into mRNA, including having one intron spliced out Be translated into a protein with the amino acid sequence: MPLEASE. I suggest starting by writing out all of the sequence elements necessary for every step of transcription and translation, so that you make sure you include each of those elements in your gene. Report...

  • 3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...

    3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC...

    A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC CAC CGC 3'. Assume the first codon for the peptide begins with the first nucleotide of the portion of mRNA and there are no introns (May not start at AUG). Enter the mRNA and amino acid sequence below

  • The three rows of boxes on this diagram represent a continuous strand of non-template DNA of...

    The three rows of boxes on this diagram represent a continuous strand of non-template DNA of E. coli. Identify the location of the promoter region in the DNA sequence on the diagram. (1) Locate and describe the function of the two conserved DNA sequences within the promoter region. (2) Indicate the approximate location on the diagram where transcription will start and begin “synthesizing” mRNA at that point. (1) Identify the location sequence on the diagram that will terminate transcription and...

  • 6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding strand is...

    6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding strand is provided) transcribe the sequence into mRNA. Assume transcription starts at the first nucleotide of the provided sequence that is, the promoter region is not shown). b) Translate the mRNA strand from part a to the correct amino acid sequence The codon chart is provided BIANIE BSN

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • 1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the...

    1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...

  • Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...

    Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....

  • A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence...

    A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The intron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly-A tails are added following the sequence AGUUGG. The poly-A tails are 20 nucleotides. b. If this is an oncogene that is elevated in cancer cells, design two siRNAs to knock down the mRNA, list the sequences of the siRNAs...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT