Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule.
5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)
a. Which strand will serve as the template strand for transcription?
b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and 3’ ends of the mRNA and any additional elements found in mature mRNA.
c. Based on your mRNA sequence, draw a line between each codon in part b, above, and write the sequence of the polypeptide that can be translated from the N-terminus to C-terminus. Be careful of the codons you choose and be sure to label the N- and C- termini of the sequence you write.
d. If Cas9 used an 8 bp long guide RNA sequence, which of the following sequences would be best knock out this gene assuming that Cas9 cuts the DNA down the middle of the guide RNA sequence? Explain your choice and why the other guide RNA is not ideal. Include in your answer a description of why cutting by Cas9 will result in a knockout of the gene where no functional protein being produced.
Guide RNA #1: 5’ACCGAUCA 3’ Guide RNA #2: 5’ATCGCGCT 3
DNA sequence given -
5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top)
3’TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)
a. Answer- 5’
ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) - Coding
strand
3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)
-Template strand
b.Template starnd will be used to obtain the mRNA-
3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) -Template strand
The Adenine base will change to the Uracil in mRNA.
First it will form the pre mRNA -
5' AUCGCGCUCAGCUAGUACCGAUCAGCAGUCAGCAGUCAGCAUCGGU 3'- pre- mRNA
The intron region (shown in purple) will be spliced ,only flanking exon join to form the mature mRNA.
5' AUCGCGCUCAGCUAGCAGUCAGCAUCGGU 3' - Mature mRNA .
C. 5' AUC GCG CUC AGC UAG CAG UCA GCA UCG GU 3' - Mature mRNA .
Mature mRNA will code for the amino acid (polypeptide sequence).
N' terminal Ile- Ala-Leu-Ser-stop-Gln-Ser-Ala-Ser C' terminal.
D. Guide RNA #1: 5’ACCGAUCA 3’
Guide RNA #1: 5’ACCGAUCA 3’ will bind to the intron region and get spliced off, thus would be best for knock out this gene assuming that Cas9 cuts the DNA down the middle of the guide RNA sequence.
5' AUCGCGCUCAGCUAGUACCGAUCAGCAGUCAGCAGUCAGCAUCGGU 3'- pre- mRNA
Guide RNA #2: 5’ATCGCGCT 3 -binds to exon region,thus will not be helpful for the knockdown.
5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top)
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
2. For the following short segment of a DNA strand, complete the
following table. The codon dictionary is provided for you on the
previous page.
Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...
A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC CAC CGC 3'. Assume the first codon for the peptide begins with the first nucleotide of the portion of mRNA and there are no introns (May not start at AUG). Enter the mRNA and amino acid sequence below
3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in the top (5' to 3) strand. 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG- 3' 3-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC- 5' Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM, the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will keep binding to other PAM sequences until it finds the...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.