Ans 3- PAM are protospacer adjacent motif that is require for Cas9 to function. It varies depending on the bacterial species of the Cas9 gene. Streptococcus pyogenes derived Cas9 nuclease is most commonly used nuclease that recognizes a PAM sequence of NGG.
PAM sequences in given DNA sequences are as follows:-
5'GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG-3'
3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in...
PART 3: Designing a Guide RNA You will now design your own guide RNA to inactivate a butterfly gene like Robert Reed did. Your goal is to knock out the optix gene in a species of butterfly called the painted lady (Vanessa cardu). Activity Stander Biointeractive Using CRISP other Your guide RNA must match a target DNA sequence in the gene that you want to knock out. A partial sequence of an exon from the butterfly's aptix gene is shown...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
4. What is the function of each component of the CRISPR-Cas9 system? (1.5 pt) PAM site: Guide RNA: Cas9: 5a. In the DNA below, the "I" line indicates where there is a mutation in a gene. Design a gRNA to find this mutation. Your gRNA will be 8 bases long and will not include the PAM sequence. Keep the following in mind: [2 pts total] i. Scan the top strand left to right and find the PAM site. ii. When...
4. The CRISPR-Cas9 system is an important new technique in
molecular biology. What is the natural function of this system?
Describe how you would use this system to generate a null mutation
in another organism (i.e. explain Figure 6-43). How does it work?
What is the modification of the method that allows for correction
of a mutation (e.g. the mouse crystalline gene)? And lastly, what
are the problems with the CRISPR system?
FIGURE 6-43 Single-nucleotide mutations
can be introduced into...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
3) Antibodies can be membrane-bound or secreted, depending on whether a stretch of additional amino acids are present or not. What process do you think determines if these amino acids are present? postranslational covalent attachment of a membrane spanning domain to the antibody alternative RNA splicing phosphorylation polyadenylation ubiquitin addition 10) How does the Cas9 system target where it produces a double-strand break in the DNA? The Cas9 protein binds to a recombinase, allowing it to disable the gene of...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.