Answer:
a).
Template DNA: 3’ GCT-TTT-CAA-AAA - 5’
mRNA : 5’ CGA-AAA-GUU-UUU-3’
b).
Anticodon: 3’ GCU-UUU-CAA-AAA - 5’
c).
mRNA : 5’ CGA - AAA - GUU - UUU-3’
Amino acid : Arg(R) - Lys (K) - Val(V) - Phe(F)
11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT |...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC CAC CGC 3'. Assume the first codon for the peptide begins with the first nucleotide of the portion of mRNA and there are no introns (May not start at AUG). Enter the mRNA and amino acid sequence below
C) a (energy required) minus, the C-terminus, and box all the peptide 33) (8 pts) Draw the te bonds 34) (7 pts) The following sequence of triplets is in the template DNA strand: 3 GGGI TCAI CCAI AGT 5. Write the corresponding mRNA section and label the 3 and 5' ends. What sequence of amino acids would be placed in a peptide chain? Module 9 Worksheet Page 1
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...