Question

C) a (energy required) minus, the C-terminus, and box all the peptide 33) (8 pts) Draw the te bonds 34) (7 pts) The following
0 0
Add a comment Improve this question Transcribed image text
Answer #1

(33) val-leu-glu-ser only OH u -oor Tc-NE Hi ] 10 {1- 1 - peptide linkage}

Add a comment
Know the answer?
Add Answer to:
C) a (energy required) minus, the C-terminus, and box all the peptide 33) (8 pts) Draw...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT |...

    11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.

  • I have my own answers, i just want to check my work, thanks! Given the DNA...

    I have my own answers, i just want to check my work, thanks! Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...

  • Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...

    Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...

  • Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule...

    Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • Consider the most common Cystic Fibrosis variant: Wild-type CFTR DNA (Coding-strand): 3 ATC ATC TTT GGT...

    Consider the most common Cystic Fibrosis variant: Wild-type CFTR DNA (Coding-strand): 3 ATC ATC TTT GGT GTT atc att ggt gtt... Cystic Fibrosis odi 1. Add the 5' and 3' designations to the DNA. 2. Write the template sequence for the DNA 3. Transcribe the wild-type and CF DNA into mRNA. Be sure to include the 5'/3' labels. 4. Translate the wild-type and CF mRNA into protein. Be sure to label these ends also. 5. In the above wild-type protein,...

  • All are the same diagrams Consider the following double-stranded region of a gene: Strand 17 5'-...

    All are the same diagrams Consider the following double-stranded region of a gene: Strand 17 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2 3-TTAGCATACGCTTCGGGAATTGA - 5 The number of mRNA codons in the corresponding transcript is: A 1 3.4 OC5 E Cannot be determined Consider the double-stranded DNA sequence of a gene below: Strand 1: 5'-AATCGTATGCGAAGCCCTTAACT-3' Strand 2. 3'-TTAGCATACGCTTCGGGAATTGA-5 The number of amino acids in the corresponding peptide is: OOOOO du . w Consider the following double-stranded region of a gene below: Strand 17...

  • Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...

    Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...

  • Does the Death Penalty Costle X Files x 9.2 DNA Replication - Concept x + om/courses/19926/files?preview=1637200...

    Does the Death Penalty Costle X Files x 9.2 DNA Replication - Concept x + om/courses/19926/files?preview=1637200 cure Checkout Concepts of Biology Lifespan Developm. 111FAQ2020.docx 111 terms pdf 111welcome2020 pdf Page < 1 > of 3 - ame: Section DNA Replication Worksheet (10 Points) Instructions: Below is a representation of a DNA double helix about to be replicated. Using pencil, draw and label the following items according to the instructions for each. 1) Label the S' and 3' ends of both...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT