Question

Consider the following double-stranded region of a gene: Strand 17 5- AATCGTATGCGAAGCCCTTAACT-3 Strand 2 3-TTAGCATACGCTTCGG

Consider the double-stranded DNA sequence of a gene below: Strand 1: 5-AATCGTATGCGAAGCCCTTAACT-3 Strand 2. 3-TTAGCATACGCTTConsider the following double-stranded region of a gene below: Strand 17 5- AATCGTATGCGAAGCCCTTAACT-3 Strand 2. 3-TTAGCATA

All are the same diagrams

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question 1 &2

number of mRNA codon in the given template: 5

number of amino acid: 4

Central dogma of molecular biology: this is the production of proteins (amino acids) from the genetic information encoded in the DNA or simply DNA into RNA into PROTEIN. This is brought about by 2steps namely Transcription and Translation.

Transcrption is the process of producing an mRNA from the genetic DNA. This processs happens in the nucleus of the cell. DNA is double stranded with strands running in anti parallel direction. ie. One strand from 5’ to 3’ and opposite in 3’ to 5’. Here the 5’ to 3’ strand is called the sense strand. It is also known as plus strand or non template strand. 3’ to 5’ strand is called the anti sense strand. It is also called as non coding strand -strand or template strand. Nucleotides (monomer unit of DNA) consists of nucleotide base, deoxy ribose sugar and a phosphate group. Nitrogen based of DNA are Adenine(A),Cytosine (C), Guanine (G), Thymine. In RNA this Thymine is replaced by Uracil.

Transciption : The 3’ to 5’ act as the template for the formation of mRNA. Complementary base pairing occurs substituting adenine to Uracil instead of Thymine

for the given example

5’ A A T C G T A T G C G A A G C C C T T A A C T 3’

3’ T T A G C A T A C G C T T C G G G A A T T G A 5’ : Template strand

5’ A A U C G U A U G C G A A G C C C U U A A C U 3’ mRNA

1 2 3 4 5   

start stop

mRNA forms by adding complementary base pair to this given 3’ to 5’ stand. (mRNA strand is exactly the 5’ to 3’ strand replacing T with U. )

now this mRNA moves outside the nucleus to the ribosomes were the proteins are synthesized. There is a start codon to begin the synthesis and stop codon to end the process. Codons are a group of 3 nucleotides with codes for specific amino acids. Each codon codes only for specific amino acid there might be more than one codon for an amino acid

start codon : AUG. protein synthesis doesn’t start until they find a start codon. And AUG always code for methionine.

end codon : UAA, UAG, UGG these are the stop codon and they don’t code for any amino acid. Protein synthesis stops while encountering any one these codes.

Question 3 upstream to 5’ end

Promoter : It the site were the transcription starts by the binding of RNApolymerase enzyme after the unzipping of double stranded DNA helix by the helicase enzyme. In eukaryotes the main promoter sequence are TATAAA , GGGCGG.. AT bonds are easy to break than CG bonds because AT base paring occurs by two hydrogen bonds and CG pairing by 3 hydrogen bonds.

Add a comment
Know the answer?
Add Answer to:
All are the same diagrams Consider the following double-stranded region of a gene: Strand 17 5'-...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Consider the double-stranded DNA sequence of a gene below: Strand 1 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2. С...

    Consider the double-stranded DNA sequence of a gene below: Strand 1 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2. С стената. 3. TTAGCATACGCTTCGGGAATTGA-5' The number of amino acids in the corresponding peptide is: OA.O B.1 OC3 0.4 O E.5 Consider the following double-stranded region of a gene: Strand 17 5'- AATCGTATGCGAAGCCCTTAACT-3 Strand 2A 3'-TTAG CATACGCTTCGGGAATTGA-5 The number of mRNA codons in the corresponding transcriptis O A1 OB.4 OC.5 OD.6 E. Cannot be determined

  • DNA is double stranded, but only one strand is used as a template for transcription. How...

    DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...

  • 1. Label the template and coding strand. Label upstream and downstream ends.

    1. Label the template and coding strand. Label upstream and downstream ends.2. On the template strand identify the promoter.3. Identify the start site.4. Block off and number the triplets to be transcribed.5. Create the pre-mRNA. Label 5’ and 3’ ends.6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons.7. Identify the utrs (untranslated regions).8. Add a 5’ cap to the 5’ end of the mRNA transcript and a poly-A-tail to the 3’ end.9. Block off...

  • Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to...

    Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...

    Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...

  • Below is the partial coding strand of DNA for a gene containing an ORF, shown 5'...

    Below is the partial coding strand of DNA for a gene containing an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9, associated with the following genetic elements. Some elements may have more than one associated region. (a) The promoter region (b) The ribosome binding site (c) The ribosome binding site consensus sequence (d) The start codon (f) The expected region for the +1 transcription (where the transcript begins to be made) (g) Is this a prokaryotic...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features...

    QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...

  • Consider the following segment of DNA is part of a gene,

    Consider the following segment of DNA is part of a gene, Left  5'.... ACTGACTGACAGTC..3'        3'.... TGACTGACTGTCAG... 5'  RIGHT during RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please predict the peptide sequence(s) produced from the mRNA transcribed from this segment of DNA. (Hint: First determine the mRNA sequence, then use the genetic codon table to...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT