Question

Below is the partial coding strand of DNA for a gene containing an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9, associated with the following genetic elements. Some elements may have more than one associated region.

(a) The promoter region

(b) The ribosome binding site

(c) The ribosome binding site consensus sequence

(d) The start codon

(f) The expected region for the +1 transcription (where the transcript begins to be made)

(g) Is this a prokaryotic or eukaryotic gene? Give 2 pieces of evidence that support your answer.

3 -35 -10 AGCTTGACA7GCGGTGTACCGTCATTATAATCGCCATCTCAGTGTGCAAGGAGG 6 ACTUACGATGCCGCTGGACGCCTGTTATATTGAGATCGCTGATCGATCTAGGC GGCT

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Coding strand of DNA has the same sequence as the mRNA except T of DNA is replaced by U in mRNA.

  1. Promoter region: It is shown by 1 along with region 2. Promoter region is located upstream of the DNA on the 5’ end of the coding strand. It encompasses from -35 region to +1. At -35 it has -35 box which has consensus sequence TTGACA, and at -10 it has -10 box which has consensus sequence TATAAT.
  2. Ribosome binding site: It is shown by 4. As ribosome binds 3-10 nucleotides up the start codon AUG on mRNA.
  3. Ribosome binding site consensus sequence: It is shown by 4. This sequence 5’ AGGAGG 3’ on the mRNA. On DNA coding strand it is 5’ AGGAGG3’.
  4. The start codon : is present in region 5. Start codon is 5’ AUG 3’ on mRNA. It is 5’ ATG 3’ on DNA coding strand.
  5. The expected region for +1 transcription is in region 3 after the TATAAT box.
  6. It is a prokaryotic gene because it has TATA box at -10 with sequence TATAAT and shine delgarno sequence 5’ AGGAGG 3’.
Add a comment
Know the answer?
Add Answer to:
Below is the partial coding strand of DNA for a gene containing an ORF, shown 5'...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures...

    6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...

  • region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...

    region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...

  • 1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription...

    1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription start site is in bold (+1). Draw boxes around and label the consensus sequences found in this type of promoter. 5' AGTTAGGTATTGACATGATAGAAGCACTCTACTATAATTCAATAGGTCCAC 3 2) A partial peptide sequence for the wild type and three mutant alleles of a gene, PET1, are shown below. Each mutant was caused by a substitution, addition, or deletion of a single nucleotide. Determine the exact coding DNA sequence of...

  • 6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding strand is...

    6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding strand is provided) transcribe the sequence into mRNA. Assume transcription starts at the first nucleotide of the provided sequence that is, the promoter region is not shown). b) Translate the mRNA strand from part a to the correct amino acid sequence The codon chart is provided BIANIE BSN

  • A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence...

    A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The intron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly-A tails are added following the sequence AGUUGG. The poly-A tails are 20 nucleotides. b. If this is an oncogene that is elevated in cancer cells, design two siRNAs to knock down the mRNA, list the sequences of the siRNAs...

  • 11. Using the DNA sequence below and the codon table on the projector, perform the following:...

    11. Using the DNA sequence below and the codon table on the projector, perform the following: a. Produce the correct MRNA transcript. On the DNA sequence below, the top strand is the template strand, and transcription begins immediately following the promoter sequence and ends at the end of the DNA sequence. (5 points) b. Produce the correct polypeptide sequence. (5 points) Prometer GTCACGGGTACCCTGTGTTAAGGCATCGTATGATACATACCACTATGTACCATGGACACAATTCCGTAGCATAAGCATGACCC CAGTGCCCATGGGACACAATTCCGTAGCATACTATGTATGGTGATACATGGTACCTGTGTTAAGGCATCGTATTCGTACTGGG 11. Using the DNA sequence below and the codon table on the projector, perform the following:...

  • 2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not...

    2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not draw the non-template strand. Label the 5' and 3' ends of the DNA. Label the promoter, coding region, and termination site. Draw RNA polymerase halfway through the process of transcription, and the RNA it has produced.

  • Shown below is the sequence of a coding strand of DNA that begins with what corresponds...

    Shown below is the sequence of a coding strand of DNA that begins with what corresponds to the translation start codon (AUG) in the mRNA transcript. You are analyzing two different mutants. Mutant #1 has an extra C residue after the underlined G residue and Mutant 2 has a deletion of the underlined A residue. Wild type 5’- ATGCTTACTGAGGTCATGGTACAGATGA Mutant 1 5’- ATGCTTACTGCAGGTCATGGTACAGATGA Mutant 2 5’- ATGCTTACTGAGGTCATGGTCAGATGA What is the amino acid sequence of the polypeptide encoded by: B. The...

  • Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...

    Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...

  • 1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the...

    1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT