Question

11. Using the DNA sequence below and the codon table on the projector, perform the following: a. Produce the correct MRNA tra
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Since the mRNA is transcribed from template strand and it's sequence is same to sense strand. Thus, the mRNA sequence will be

UGGUGAUACAUGGUACCUGUGUUAAGGCAUCGUAUUCGUACUGGG
Since, translation will start from AUG codon, therefore the amino acid sequence will be
Methionine-valine-Proline-Valine-Leucine-Arginine-Histidine-Arginine-Isoleucine-Arginine-Threonine-Glycine

Add a comment
Know the answer?
Add Answer to:
11. Using the DNA sequence below and the codon table on the projector, perform the following:...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to...

    Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...

  • 6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...

    6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • 1) Using the bacterial DNA sequence that the instructor gave you:

    1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume...

    using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:

  • 2. For the following short segment of a DNA strand, complete the following table. The codon...

    2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page. Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...

  • 1. Label the template and coding strand. Label upstream and downstream ends.

    1. Label the template and coding strand. Label upstream and downstream ends.2. On the template strand identify the promoter.3. Identify the start site.4. Block off and number the triplets to be transcribed.5. Create the pre-mRNA. Label 5’ and 3’ ends.6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons.7. Identify the utrs (untranslated regions).8. Add a 5’ cap to the 5’ end of the mRNA transcript and a poly-A-tail to the 3’ end.9. Block off...

  • A portion of DNA sequence is    5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top)    3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)...

    A portion of DNA sequence is    5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top)    3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT