2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not...
2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not draw the non-template strand. Label the 5' and 3' ends of the DNA. Label the promoter, coding region, and termination site. Draw RNA polymerase halfway through the process of transcription, and the RNA it has produced.
Homework Answers
Add Answer to:
2. (3 pts) Draw a gene! Draw only the template strand of the
DNA. Do not...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now,...
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now, it is preparing Renes in this region. Using pencil draw in and label the following items according cule from above. Now, it is preparing for transcription of the and label the following items according to the instructions. 1) Label template and non-template strands 2) Label 5' and 3' ends of template and non-template strand 3) Draw in and label RNA polymerase 4) Label transcription...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The...
RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The RNA polymerase holoenzyme binds to the promoter A process called clearance or escape. Reaching a terminator sequence causos formation of phosphodiester bonds to stop. The RNA polymerase holoenzyme is formed. Once bound to the promoter, RNA polymerase begins to unwind the DNA. New nucleotides are added to the 3' end of the growing RNA transcript. The RNA-DNA hybrid within the transcription bubble dissociates New...
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the...
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the direction of transcription. Draw the corresponding RNA molecule and label the 5' and 3' ends
1. 3 pts each 30 pts total) Fill in each blank with the best word or phrase selected from the lis...
1. 3 pts each 30 pts total) Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once charged transduction lytic - strand promoter RBS lysozyme conjugation retrovirus RNA sigma factor clear origin transformation uncharged recombination +strand lysogen pause site cloudy Before transcription can begin, RNA polymerase finds the location and direction of a gene within the DNA based...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now, it is preparing Renes in this region. Using pencil draw in and label the following items according cule from above. Now, it is preparing for transcription of the and label the following items according to the instructions. 1) Label template and non-template strands 2) Label 5' and 3' ends of template and non-template strand 3) Draw in and label RNA polymerase 4) Label transcription...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The RNA polymerase holoenzyme binds to the promoter A process called clearance or escape. Reaching a terminator sequence causos formation of phosphodiester bonds to stop. The RNA polymerase holoenzyme is formed. Once bound to the promoter, RNA polymerase begins to unwind the DNA. New nucleotides are added to the 3' end of the growing RNA transcript. The RNA-DNA hybrid within the transcription bubble dissociates New...
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the direction of transcription. Draw the corresponding RNA molecule and label the 5' and 3' ends
1. 3 pts each 30 pts total) Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once charged transduction lytic - strand promoter RBS lysozyme conjugation retrovirus RNA sigma factor clear origin transformation uncharged recombination +strand lysogen pause site cloudy Before transcription can begin, RNA polymerase finds the location and direction of a gene within the DNA based...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago