Question

Consider the double-stranded DNA sequence of a gene below: Strand 1 5- AATCGTATGCGAAGCCCTTAACT-3 Strand 2. С стената. 3. TT
Consider the following double-stranded region of a gene: Strand 17 5- AATCGTATGCGAAGCCCTTAACT-3 Strand 2A 3-TTAG CATACGCTTC
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1.) The number of amino acid is- 4

5'- AATCGTATGCGAAGCCCTTAACT -3' Coding strand of DNA

5'- AAUCGUAUG CGA AGC CCU UAACU -3' mRNA strand

Met Arg Ser Pro STOP

Add a comment
Know the answer?
Add Answer to:
Consider the double-stranded DNA sequence of a gene below: Strand 1 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2. С...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • All are the same diagrams Consider the following double-stranded region of a gene: Strand 17 5'-...

    All are the same diagrams Consider the following double-stranded region of a gene: Strand 17 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2 3-TTAGCATACGCTTCGGGAATTGA - 5 The number of mRNA codons in the corresponding transcript is: A 1 3.4 OC5 E Cannot be determined Consider the double-stranded DNA sequence of a gene below: Strand 1: 5'-AATCGTATGCGAAGCCCTTAACT-3' Strand 2. 3'-TTAGCATACGCTTCGGGAATTGA-5 The number of amino acids in the corresponding peptide is: OOOOO du . w Consider the following double-stranded region of a gene below: Strand 17...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...

    Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...

  • Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a...

    Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...

  • 11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT |...

    11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.

  • In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....

    In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom. A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule. B) Create an mRNA strand that is complementary to DNA Strand 1. C) Using the mRNA sequence that you just created, determine the complementary...

  • The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT...

    The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • 6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...

    6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT