Question

In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule.

B) Create an mRNA strand that is complementary to DNA Strand 1.

C) Using the mRNA sequence that you just created, determine the complementary tRNA anticodon sequences.

DNA Strand 1 DNA Strand 2 mRNA Strand tRNA Strands Amino Acids A opposite T C opposite G A opposite U C opposite G A opposite

0 0
Add a comment Improve this question Transcribed image text
Answer #1

a) DNA

T- A

G- C

A- T

G-C

G-C

A-T

b) m-RNA

A

C

U

C

C

U

C)t-RNA

U

G

A

G

G

A

D) amino acid

ACU- threonine , CCU- proline

Add a comment
Know the answer?
Add Answer to:
In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...

    PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the answers below. (Select more than 1 answer) The coding strand is the first strand running from 5' to 3'. The coding strand is the second strand running from 3' to 5'. The template strand is the second strand running from 3' to 5'. The template strand is the first strand running from 5' to 3'. 2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...

  • Use this DNA sequence to answer these five questions T A CGGGACATAG Choose mplementary sequence of...

    Use this DNA sequence to answer these five questions T A CGGGACATAG Choose mplementary sequence of mRNA bases tRNA anticodon bases complementary sequence of DNA bases sequence which complements the mRNA Choose... Choose.. Choose.. Choose Met-Pro-Cys-lleu ATG CCCTGTATC UACGGGACAUAG sequence of amino acids which would result during translation A U C age

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the...

    DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • .Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A...

    .Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • How DNA Is Copied 4. What does it mean that the two strands of DNA are...

    How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT