1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’
2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1.
3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate?
4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule.
5. What enzyme is responsible for transcription? Where in the cell does transcription take place?
6. Translate the mRNA molecule from question #4. Show order of amino acids in the polypeptide.
7. Indicate the anticodons of the tRNA molecules, in the correct order, that were used to produce the polypeptide in question #6.
8. Create a nonsense mutation in the DNA molecule from question #1 (show the DNA sequence with the mutation highlighted). Show the effect the mutation has on the RNA sequence and the protein.
Answer for question number 1 :
Given DNA sequence : 5’ ATGCGTATACGTTCCGTCGCCTAA 3’
Complementary strand : 3’TACGCATATGCAAGGCAGCGGATT 5’
This is due to base pairing specificities given by Chargoff.
Adenine base pairs with Thymine by two hydrogen bonds and
Guanine base pairs with Cytosine by three hydrogen bonds
Adenine and Guanine = Purines
Thymine and Cytosine = Pyrimidines
Answer for question number 2 : DNA polymerases are the enzymes that synthesizes the complementary strands according to the base pairing rules which are given above.
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA GA CAT-3 a. To an mRNA? b. Read and translate the codons on m-RNA into the appropriate amino acids. c. If a mutation of the 9h base from the 3' end is mutated from an A-adenosine to T-thymine, how does this change the amino acid sequence? Be specific by redoing the problem with this one mutation. In a frame shift mutation, one base is...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...