Question

Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA GA CAT-3 a. To an mRNA? b. Read and translate the codons on m-RNA into the appropriate amino acids. c. If a mutation of the 9h base from the 3 end is mutated from an A-adenosine to T-thymine, how does this change the amino acid sequence? Be specific by redoing the problem with this one mutation. In a frame shift mutation, one base is either added or deleted. If now we add a G-Guanine to the 9th d. position from the 3 end, how does this mutation change the sequence of amino acids produced? e. Explain how this frame shift mutation is probably responsible for many of the enzyme genetic defect diseases? Show with an example


0 0
Add a comment Improve this question Transcribed image text
Answer #1

The given template DNA strand is

5' ACATTAGTCAGTAGACAT 3'

Ans A) For mRNA formation the coding strands are 3' TGTAATCAGTCATCTGTA 5'.

The mRNA is formed by the cexact coping of the DNA coding strands where the Thymine js replaced by Uracil. The mRNA formed is 5' UGU AAU CAG UCA UCU GUA 3' after transcription.

Ans B) The mRNA is translated to the protein. The protein is 5' Cys-Asn-Gln-Ser-Ser-Val 3'

Ans C) A mutation occur at the 9 postion of the DNA from the 3' side. Now the template strand is

5' ACATTAGTCTGTAGACAT 3'

The coding strands is 3' TGTAATCAGACATCTGTA 5'.

The translated mRNA strand is 5' UGU AAU CAG ACA UCU GUA 3 and the proteined formed is

5' Cys-Asn-Gln-Thr-Ser-Val 3'

Due to the mutation Serine is replaced by threonine.

Ans 4) Now a Guanine is inserted at the 9 position of the 3' site. Now the template DNA is

5' ACATTAGTCGGTAGACAT 3'.

The coding strand is 3' TGTAATCAGGCATCTGTA 5'.

The mRNA is 5' UGU AAU CAG GCA UCU GUA 3

The translated protein is 5' Cys-Asn-Gln-Ala-Ser-Val 3'.

Add a comment
Know the answer?
Add Answer to:
Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...

    Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into...

    Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’                                                                                                                                                                           5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • Mutation 3: ATG-TCA-GAT-CAG-CGG-ATC-CTA-TAG a. Replicate the DNA strand above (the original base has been replaced with...

    Mutation 3: ATG-TCA-GAT-CAG-CGG-ATC-CTA-TAG a. Replicate the DNA strand above (the original base has been replaced with the red one) b. Transcribe the replicated mutated strand to mRNA c. Translate the mRNA produced above to an amino acid sequence: d. What kind of mutation is this?

  • One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’

    One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...

    Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT