Question

5 Template DNA Amino Template DNA Amino acid 3 emplate DNA

The three rows of boxes on this diagram represent a continuous strand of non-template DNA of E. coli.

Identify the location of the promoter region in the DNA sequence on the diagram. (1)

Locate and describe the function of the two conserved DNA sequences within the promoter region. (2)

Indicate the approximate location on the diagram where transcription will start and begin “synthesizing” mRNA at that point. (1)

Identify the location sequence on the diagram that will terminate transcription and stop “synthesizing mRNA after that sequence. (1)

Identify the type of transcription termination that this represents (1)

Identify the location of the sequence on the diagram where the mRNA transcript binds with the ribosome and provide the name of this sequence. (2)

Identify the location where translation would begin on the diagram. (1)

Identify the location where translation would terminate on the diagram. (1)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

DNA:-    1 TGGCCGCTAACTGTAAACTTTACCAAGGCGGACATATTA39

mRNA:- ACCGGCGAUUGACAUUUGAAAUGGUUCCGCCUGUAUAAU

AA:-       ACC|GGC|GAU|UGA|CAU|UUG|AAA|UGG|UUC|CGC|CUG|UAU|AAU

DNA:-    40CCCACTTACTCACAGCCTCCTCCATACTGGACAGGAATC79

mRNA:-GGGUGAAUGAGUGUCGGAGGAGGUAUGACCUGUCCUUAG

AA:-      GGG|UGA|AUG|AGU|GUC|GGA|GGA|GGU|AUG|ACC|UGU|CCU|UAG

DNA:-   80CTTTTCTCTTCGGGCGGATTACTCATCCGAAAAAATCGT119

mRNA:- GAAAAGAGAAGCCCGCCUAAUGAGUAGGCUUUUUUAGCA

AA:-      GAA|AAG|AGA|AGC|CCG|CCU|AAU|GAG|UAG|GCU|UUU|UUA|GCA

At -10 upstream to the start of the transcription initiation site, TATAAT region is present. At -35 upstream to the transcription initiation site, GACATT is present. Both these sites are considered as the contributors of promoter region in E.Coli.

TATAAT and TTGACA are the two conserved sequences in the E.Coli promoter.

Transcription starts from the 49th nucleotide of the DNA sequence. mRNA is synthesized from that point (AGUGUC……)

Transcription is terminated at the poly A sequence ending of DNA

The type of termination of transcription is rho-independent

The ribosome attaches to the mRNA at the 64th nucleotide of mRNA which starts translation for methionine (AUG).

Translation begins at the 64th position of mRNA and protein starts from here.

Translation terminates at the 79th position of mRNA that has the codon of UAG (stop codon)

The sequence of protein is AUGACCUGUCCUUAG

Add a comment
Know the answer?
Add Answer to:
The three rows of boxes on this diagram represent a continuous strand of non-template DNA of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...

    One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

  • 1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...

    1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?

  • 4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...

    4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...

  • Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and...

    Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...

  • 4. Given the following information: One strand of a section of DNA isolated from E. coli...

    4. Given the following information: One strand of a section of DNA isolated from E. coli reads                                     5’-GTAGCCTACCCATAGG-3’                                     3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...

  • One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’

    One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The...

    RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The RNA polymerase holoenzyme binds to the promoter A process called clearance or escape. Reaching a terminator sequence causos formation of phosphodiester bonds to stop. The RNA polymerase holoenzyme is formed. Once bound to the promoter, RNA polymerase begins to unwind the DNA. New nucleotides are added to the 3' end of the growing RNA transcript. The RNA-DNA hybrid within the transcription bubble dissociates New...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT