1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning properly?
| photoreactivation repair |
| base excision repair |
| SOS repair |
| double-strand break repair |
| nucleotide excision repair |
2.
In bacteria and eukaryotes, a mutation is when ________.
In bacteria and eukaryotes, a mutation is when ________.
| A.the nucleotide sequence in an mRNA molecule is directly changed |
| B.the nucleotide sequence in a DNA molecule is directly changed |
| C.the amino acid sequence in a protein molecule is directly changed |
| D, DNA is unable to be replicated |
| E. the expression of a gene changes without the DNA sequence being changed |
3.
A mutation that changes an amino acid-coding codon to a stop codon is classified as what kind of codon?
A mutation that changes an amino acid-coding codon to a stop codon is classified as what kind of codon?
| A.silent |
| B.neutral |
| C.conditional |
| D.nonsense |
| E.missense |
4.
Germ cell mutations ________.
Germ cell mutations ________.
| A.affect somatic cell function in the current generation |
| B.are usually found in every cell of the next generation |
| C.are the cause of testicular cancer |
| D.are of no consequence to the next generation |
| E. are only seen in females |
1. The repair mechanism most likely affected, if the DNA glycosylase not functioning properly is Option B. BASE EXCISION REPAIR. As in this repair mechanism, the enzyme DNA glycosylase cleaves the N- glycosylic bonds liberating the altered base and generating an apurinic or an apyrimidinic site.
2. In bacteria and eukaryotes, mutation is Option B. THE NUCLEOTIDE SEQUENCE IN A DNA MOLECULE IS DIRECTLY CHANGED.
3. A mutation that changes an amino acid-coding codon to a stop codon is classified as Option D. NONSENSE MUTATION.
4. Germ cell mutations Option B.are usually found in every cell of the next generation. As germ cell mutation refers to any detectable variation within germ cells i.e., sperm and ovum. Mutations in these cells can be passed on to offspring, when either a mutated sperm or oocyte come together to form a zygote. So every cell of the next generation will have the same mutation.
1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning...
In bacteria and eukaryotes, a mutation is when ________. the amino acid sequence in a protein molecule is directly changed the nucleotide sequence in an mRNA molecule is directly changed the nucleotide sequence in a DNA molecule is directly changed the expression of a gene changes without the DNA sequence being changed
Ul Ehé question paper. 1. Mutations can be caused by: a) tautomeric shifts b) UV light c) chemical changes to bases such as deaminatior C) all the above 2. The start of a wild type mRNA was AUGCCCAAGAccA mu tation This type of change resulted in the sequence AUGUCCAAGACC. is called a a) missense一®.frameshift mutation. 3. The typical rate of mutation for a human gene is per generation. a) 103 c) 10 d) 10-11 e) 104 4. If a hypothetical...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...
10. Examine more closely how DNA changes in a co questions. Write the codon for the DNA sequence ATA then change only one nucleotide so that it codes for an RNA codon that is a STOP codon. If a codon changes to cause an mRNA to have a STOP codon instead of a codon for an amino acid, what type of protein mutation is this? Write the RNA codon(s) for histidine then change the last letter to a "G." What...
13) The number of new mutations in a given gene per cell generation is called? B) mutation rate C) recombination frequeney 14) A type of spontaneous mutation that occur when a purine base is removed from the DNA is A) deamination D) alkylate bases В) apurination E) base analog C) thymine dimers 15) A type of spontaneous mutation that involves a temporary change in the base conformation because the keto group may change to an enol functional group or amino...
QUESTION Which one of the following statements is correct? A Anonsense mutation changes a stop codon to an amino-acid coding codon B: A nonsense mutation changes an amino-acid codon to a stop codon C: A silent mutation changes the amino acid sequence of the polypeptide D. A missense is usually more severe than a nonsense mutation E A Silent mutation is usually more severe than a missense mutation QUESTIONS "In a plant in which 2n - 24. what is the...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
can you guys please give me the correct answers and explain
why?
3. Which of the following statements is CORRECT? A. Exposure of E.coli to UV light greatly increases the frequency of cytosine deamination B. Mutagens that intercalate into the double helix lead to the formation of thymine dimers. C) Oxidative damage to DNA usually leads to the formation of frameshift mutations. D. Some alkylating agents are mutagenic because they chemically modify amino acids in the active site of DNA...
Which type of transcriptional termination requires formation of a stem loop secondary structure in the RNA? What is the primary factor involved in the termination of RNA synthesis? Is a new nucleotide added to a growing strand of RNA at the 3′ end? DNA and associated histones compose what molecule? Be able to use a codon table to give the sequence of amino acids from an mRNA sequence. I will give you an mRNA sequence; you will indicate how many...
1)Repairing damaged DNA is essential to maintaining the integrity of the genome. One type of repair is known as nucleotide excision repair. In this system, which order do the necessary enzymes act? A) exonuclease, DNA polymerase III, RNA primase B) helicase, DNA polymerase I, DNA ligase C) DNA ligase, nuclease, helicase D) DNA polymerase I, DNA polymerase III, DNA ligase E) endonuclease, DNA polymerase II, DNA ligase 2) What might be the result if all cells had functioning telomerase? A)...