Question

1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt)

  1. 5'-ATGGGTCTAGATACC-3'
  2. 5'-ATGCGACTAGATACC-3'
  3. 5'-ATGTGACTAGATACC-3'
  4. 5'-ATGGGACTAAGATACC-3'

2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt)

  1. silent mutation
  2. frameshift mutation
  3. missense mutation
  4. nonsense mutation

3. Excision repair corrects DNA by (1pt)

  1. correcting A=T to C=G transitions
  2. detecting, removing, and replacing damaged or incorrect bases or nucleotides in a single strand of DNA
  3. removing a double-stranded fragment of damaged DNA
  4. excising the incorrect base from a nucleotide
  5. removing extraneous groups such as methyl or oxygen added by mutagens

4. Suppose there is a protein of 50 amino acids.  The 10th codon is a glutamine codon, CAG.  Below are the new codons produced by three different mutations.  From what you know about the genetic code in general, indicate which mutation is likely to be the most serious, the least serious, or the one of intermediate impact.  In a few words, explain why.

(1pt) TAG                      

(1pt) CGG  

(1pt) CAA                      

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Option d is a nonsense mutation. A nonsense mutation means a genetic mutation had occured in a DNA that results in a shorter unfinished protein product. DNA is made up of nucleotides. Usually during protein formation a DNA is read as 3 nucleotides and they are called codons. Each codon corresponds to a particular amino acid. In case of a nonsense mutatuon it results in the formation of a stop codon. Which means protein formation stops because of the change in the normal nucletide number.

Add a comment
Know the answer?
Add Answer to:
1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...

    Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....

  • Bis 101 help Question 6 1 pts 6. (1pts) The following DNA sequence 5- AGTCGCCCATGCCG-3'undergoes a...

    Bis 101 help Question 6 1 pts 6. (1pts) The following DNA sequence 5- AGTCGCCCATGCCG-3'undergoes a mutation in which an A nucleotide is inserted at the 5' end of the molecule. How would you classify this mutation? Frameshift mutation Silent mutation Nonsense Mutation Missense mutation D Question 7 2 pts 7.(2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been...

  • Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino aci...

    Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4 Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...

  • *Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift -...

    *Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...

  • The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A....

    The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A. Give the mRNA codons and tRNA anticodons that correspond with this sequence. B. Using the above piece of DNA, show a deletion, insertion, a substitution, and nonsense mutation. Which ones are frame-shift mutations? Are any of your mutations missense? Use the table of codons and amino acids in the textbook to answer this part of the question. For microbiology

  • 3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the...

    3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...

  • The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a....

    The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...

  • D) Consider that during replication of the cell. the following mutations were generated within the gene...

    D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...

  • 1) Which of the following mutations could result in a frameshift? A) a base insertion B)...

    1) Which of the following mutations could result in a frameshift? A) a base insertion B) a base deletion C) a base substitution D) either A or B E) A, B, and C 2) Which of the following point mutations would be most likely to result in a non-functioning protein? A) a single base substitution in an intron B) a single base deletion near the end of the coding sequence C) a single base deletion in the codon following the...

  • A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3' wild-type (normal) sequence 5' ATG TTC TAG CCA 3' mutant sequence a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this classification.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT