Question

3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU...
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1) given sequence is

AUU UCU UUA GCA AGA GCU

a) the amino acid sequence is

Ile-Ser-Leu-Ala-Arg-Ala

the point mutation changes to

AUU UCU UUA GCA AGA GCC

the amino acid sequence is Ile-Ser-Leu-Ala-Arg-Ala

here there is no change in the amino acid sequence so this is an example of silent mutation, both GCU and GCC codes for same amino acid. here U is changed to C,

transition mutations are mutations which changes one purine to another purine or a pyrimidine is changed to another pyrimidine and transversion mutations are mutations which change one pyrimidine to a purine, cytosine and uracil are pyrimidines so this is a transition mutation

b) Transition mutation

c) silent mutation

d) the sequence after the deletion of the last nucleotide is

AUU UCU UUA GCA AGA GC

the amino acid sequence is Ile-Ser-Leu-Ala-Arg

e) here one nucleotide is deleted so this is an example of frameshift mutation, the reading frame downstream to the mutation changes due to the deletion or addition of one or two nucleotides.

Add a comment
Know the answer?
Add Answer to:
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino aci...

    Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4 Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...

  • A wild type gene contains the DNA 3'CCG5' which would code for the amino acid glycine....

    A wild type gene contains the DNA 3'CCG5' which would code for the amino acid glycine. A mutation changed the DNA to 3'TCG5' which would code for the amino acid serine. This is an example of which of the following? Group of answer choices A silent mutation A missense mutation A nonsense mutation A frameshift mutation None of these

  • The BRCA1 c.5266dupC variant describes an insertion of a C in an exon near the 3’...

    The BRCA1 c.5266dupC variant describes an insertion of a C in an exon near the 3’ end of the gene. What effect is this likely to have on the protein sequence? it is a frameshift variant, changing all the amino acids encoded downstream of the site of insertion it is a missense variant, replacing just one amino acid with another at the site of insertion it is a nonsense variant, creating a stop codon at the site of insertion

  • *Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift -...

    *Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...

  • Please answer all.... Thank you! 81)If a polypeptide chain contains 600 amino acids, then the gene...

    Please answer all.... Thank you! 81)If a polypeptide chain contains 600 amino acids, then the gene coding for this polypeptide must contain _____. 600 nucleotides 1200 nucleotides 1800 nucleotides 1800 codons 1800 anticodons More than one of the above are correct. 82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...

  • Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton...

    Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79...

  • A gene point mutation that converts the sequence of the codon and therefore converts the encoded...

    A gene point mutation that converts the sequence of the codon and therefore converts the encoded amino acid to a stop codon: missense mutation frameshift mutation silent mutation nonsense mutation A mouse gene was identified and determined to be required for formation of heart muscle. A gene with a similar sequence was identified in the human genome. What experiment could scientists do to determine if the mouse and human genes have similar functions? The scientist could place the mutant mouse...

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • A cell that is heterozygous for a nonsense mutation in a tumor suppressor gene would most...

    A cell that is heterozygous for a nonsense mutation in a tumor suppressor gene would most likely: A) Group of answer choices B) grow but not divide C) have a normal cell cycle D) arrest and induce apoptosis E) have a slightly increased cell cycle and increased cell growth F) grow and divide uncontrollably Which of the following correctly describes an event that occurs during transcription: Group of answer choices A) A DNA molecule is chemically modified to become a...

  • Please help me with biology 1. Online exercise: Find reports that document the relationship between the...

    Please help me with biology 1. Online exercise: Find reports that document the relationship between the age of the mother and the risk for having a baby with Down Syndrome (Trisomy 21). For your interest only 2. Suppose that during transcription of a gene, RNA polymerase mistakenly inserts an incorrect base opposite the template DNA. This error results in an mRNA with an altered nucleotide sequence. Is this a mutation? For questions 3-10, consider the following mRNA, which is the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT