A wild type gene contains the DNA 3'CCG5' which would code for the amino acid glycine. A mutation changed the DNA to 3'TCG5' which would code for the amino acid serine. This is an example of which of the following?
Group of answer choices A silent mutation A missense mutation A nonsense mutation A frameshift mutation None of these

A wild type gene contains the DNA 3'CCG5' which would code for the amino acid glycine....
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
1. Amino acids have both a three letter, and a one letter code, for example the amino acid Glycine is “Gly” or “G.” There are 20 single letter codes for amino acids, which is almost an entire alphabet. (skip any letters without a corresponding amino acid) it would make. A. For example: “Ryan Smith”, would be: “Arginine, Tyrosine, Alanine, Asparagine, Serine, Methionine, Isoleucine, Threonine, Histidine” B. Take this sequence of amino acids, and write out a sequence of RNA that could...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...
help please as soon as possible
Helen has type I osteogenesis imperfecta (Oi), a genetic skeletal disorder. Shown below is her DNA sequence for a portion of the coding region of the collagen type I gene, which contains the mutation responsible for her disorder. The corresponding wild-type sequence is shown also (only one DNA strand is shown in each case). Helen Normal 5-AAACTCCACTTCTTCCAGTAC-3' 5'-AAACTCACTTCTTCCAGTAC-3' What type of mutation does Helen carry? frameshift-deletion frameshift-insertion nonsense silent missense
QUESTION 49 A type of mutation that does not alter the amino acid sequence of a polypeptide even though the nucleotide sequence has been changed. Induced mutation Nonsense mutation Silent mutation Missense mutation None of the above 2 points QUESTION 50 Which of the following is an example of DNA damage? Loss of the helix structure of the DNA. A single break in the backbone...
If the wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the sequence to THE CAT ATT HEB IGR AT? a. missense b. nonsense c. deletion d. insertion e. silent
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
Match each type of mutation to the correct example. Nonsense mutation A codon in the PAH gene with a C-to-T mutation still specifies leucine. Silent mutation An allele of the CFTR gene where a codon mutated from AAG to TAG. Missense mutation A GGT (glycine) to GAT (aspartic acid) mutation in the KRAS gene A 2 base pair deletion in the ORF of the gene encoding the Retinitis Pigmentosum GTPase Regulator Frameshift mutation Promoter mutation A T-to-G mutation - 35...