Question

1. Amino acids have both a three letter, and a one letter code, for example the...

1. Amino acids have both a three letter, and a one letter code, for example the amino acid Glycine is “Gly” or “G.” There are 20 single letter codes for amino acids, which is almost an entire alphabet.

(skip any letters without a corresponding amino acid) it would make.

A. For example:  “Ryan Smith”, would be: “Arginine, Tyrosine, Alanine, Asparagine, Serine, Methionine, Isoleucine, Threonine, Histidine”

B. Take this sequence of amino acids, and write out a sequence of RNA that could code for it.

C. Calculate the number of A, G, C and U’s in your RNA sequence.

D. Take the sequence of RNA from your answer in C and write it as a double stranded molecule of DNA. You can add a start and stop codon if you want but not required for this problem

E. Calculate the number of hydrogen bonds holding your two DNA strands together.

F. Using the DNA sequence from Part D, make a new nucleotide sequence, and if one or more amino acids are changed, please provide the new amino acid sequence in the one letter code  

i. nonsense mutation

ii. missense mutation

iii. silent mutation

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. B. CGU-UAU-GCU-AAU-UCU-AUG-AUU-ACU-CAU

C. A-7, C-5, G-3, U-12

D. 5' TAC-TCA-TTA-GTA-TCT-TAA-TCG-TAT-TGC 3'

3' ATG-AGT-AAT-CAT-AGA-ATT-AGC-ATA-ACG 5'

E. 19 X 2 for GC + 8 X 3 for AT = 62

F. For nonsense mutation, 5' TAC-TCA-TTA-GTA-TCT-TAA-TCG-TAT-TGC 3' if the thiamine in bold is replaced by A the corresponding RNA will yield CGU-UAA-GCU-AAU-UCU-AUG-AUU-ACU-CAU. Here the protein sequence will terminate due to UAA stop codon making only one amino acid Arginine (R).

For missense mutation, 5' TAC-TCA-TTA-GTA-TCT-TAA-TCG-TAT-TGC 3' if the thiamine in bold is replaced by G the corresponding RNA will yield CGU-UAU-GCU-AAU-UCU-AUG-AUU-ACU-CAG. Here the protein sequence changes to replace histidine with glutamine. Protein sequence is thus - RYAN SMITQ.

For silent mutation, 5' TAC-TCA-TTA-GTA-TCT-TAA-TCG-TAT-TGC 3' if the thiamine in bold is replaced by C the corresponding RNA will yield CGU-UAA-GCU-AAU-UCU-AUG-AUU-ACU-CAC. Here, the protein sequence will remain the same, as the altered codon also codes for the same amino acid histidine. Protein sequence is thus - RYAN SMITH.

Add a comment
Know the answer?
Add Answer to:
1. Amino acids have both a three letter, and a one letter code, for example the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5'...

    There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...

  • table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...

    table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...

  • The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in pr...

    The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in predominant form found at pH = 0. b) What is the isoelectric point? c) What is the average charge on the population of peptide macromolecules at pH = 2.2? d) What is the average charge on the population of peptide macromolecules at pH = 12.5? TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...

    What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine

  • You are given the below piece of Template DNA. What is the third amino acid in...

    You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...

  • You are given the below piece of Template DNA (the same as the previous question). How...

    You are given the below piece of Template DNA (the same as the previous question). How many amino acids are in the protein encoded by this gene? 3'AATACGGGGAGCITTACAGAATTCAAATCA5' SECOND POSITION с A G U phenyl- alanine tyrosine cysteine U serine stop leucine stop tryptophan stop U с A G U с A histidine с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с A А threonine methionine lysine arginine valine aspartic acid glutamic U с...

  • Question 6 Using the provided Genetic Code, determine the amino acid sequence of a protein when...

    Question 6 Using the provided Genetic Code, determine the amino acid sequence of a protein when the mRNA is AUGAUUGACUGA. Tyrosine – threonine – valine – glutamic acid Methionine - STOP Methionine – isoleucine – aspartic acid – STOP Lysine – arginine – glycine - STOP

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT