A gene point mutation that converts the sequence of the codon and therefore converts the encoded amino acid to a stop codon:
|
missense mutation |
||
|
frameshift mutation |
||
|
silent mutation |
||
|
nonsense mutation |
A mouse gene was identified and determined to be required for formation of heart muscle. A gene with a similar sequence was identified in the human genome. What experiment could scientists do to determine if the mouse and human genes have similar functions?
|
The scientist could place the mutant mouse gene into humans to see if humans develop without heart muscle. |
||
|
The scientist could search the human genome for genes that encode proteins that are identical to the protein encoded by the mouse gene. |
||
|
The scientist could place the normal human gene into mutant mice to see if heart muscle forms in the mouse. |
||
|
The scientist could place the normal human gene into normal mice and see if the resulting mice are viable. |
1. Option E - Nonsense mutation
Nonsense mutation: changes an amino acid to a STOP codon, resulting in premature termination of translation.
2. Option D - The scientist could place the normal human gene into normal mice and see if the resulting mice are viable.
On average, the protein-coding regions of the mouse and human genomes are 85 percent identical; some genes are 99 percent identical while others are only 60 percent identical. These regions are evolutionarily conserved because they are required for function. ... Therefore the genomes of all mammals are comparably similar.
In this way if the normsl mouse cans succesfully survive with the gene of the human it means that the the mouse and human genes have similar functions.
P.S.If this helped you please like the answer.Thankyou.
A gene point mutation that converts the sequence of the codon and therefore converts the encoded...
A new mutation has been discovered that causes cancer. You have identified the gene sequence where the mutation occurs. Below is the sequence from your mother who is normal and you who have this mutation in your DNA. Mother: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUCAACCUAUCCCUAAGGGUAAAAA 3' You: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUGAACCUAUCCCUAAGGGUAAAAA 3' What type of mutation is shown in your DNA sequence? 01) Nonsense 2) Deletion 3) Missense 4) Frame shift
There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...
A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3' wild-type (normal) sequence 5' ATG TTC TAG CCA 3' mutant sequence a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this classification.
QUESTION 49 A type of mutation that does not alter the amino acid sequence of a polypeptide even though the nucleotide sequence has been changed. Induced mutation Nonsense mutation Silent mutation Missense mutation None of the above 2 points QUESTION 50 Which of the following is an example of DNA damage? Loss of the helix structure of the DNA. A single break in the backbone...
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3' wild-type (normal) sequence 5' ATG TTG CCC CAT 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you...
genetics
3. The figure below shows the structure of the human version of the tinman gene (NK.X2-5 is the vertebrate homologue of tinman). It also shows the mutations found in the affected families and compares the homoebox, sequence of the human gene to other similar genes. Figure 3 Structure of the human NKX2-5gene, positions of mutations, and sequence comparison to related genes. 15 KB ATG TAG PES P2AS as PSAS PAAS PIS Structure of the human NKX2-5gene, positions of mutations,...
Questions 25 refers to the following scenario. You want to
investigate the genes that underlie muscle physiology in order to
treat devastating muscular diseases and to increase the steak
production at the slaughterhouse. In the laboratory you randomly
mutate the genome of mice with ENU and discover two mutants with
defects in muscle formation. You sequence the genome of these
mutants and find point mutations in the myostatin gene. Homozygous
mice with mutation 1 show increased muscle mass – mighty...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
During the course of normal human development, the muscle myosin protein becomes expressed in muscle cells but not in non-muscle cells, such as liver cells. Based on this information and your knowledge about biology, select true or false for each of the following statements. a) T/F This expression pattern could result from the muscle myosin gene being present in muscle cells but not in liver cells. b) T/F This expression pattern could result from the regulatory sequence of the muscle...