Question

*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshif
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Original- TAC ACC TTG GCG ACT

mRNA-. AUG UGG AAC CGC UGA

Aminoacid- Met- Trp- Asn- Arg- stop

Mutated 1- TAC A​​T​​​​​C TTG GCG ACT

mRNA- AUG U​​​​​​A​​​​​G AAC CGC UGA

AA seq- Met- STOP

Mutation- point mutation ( nonsense)

Effects- yes, Since due to mutation, there is codon for stopping the polypeptide synthesis, no more synthesis of polypeptide will occur. The protein is not translated and there will be absence of such protein whenever it is required. This could cause major problems.

Mutated 2 - TAC G​​​​​​AC CTT GGC GAC T

mRNA- AUG C​​​​​​UG GAA CCG CUG A

AA seq- Met- Leu- Glu- Pro- Leu

Mutation- Frameshift mutation ( insertion)

Effects- yes, due to insertion of random nucleotide, the sequence of amino acid synthesis is altered. Protein will be formed but not similar to original one.Even the protein synthesis is not complete. May have negative effects on body.

Mutated 3- TAC ACC TT​​​​​A GCG ACT

mRNA- AUG UGG AAU CGC UGA

AA seq- Met- Trp- Asn- Arg- stop

Mutation- point mutation ( silent)

Effects- No, there will be no such effects because after mutation, there is no change in the protein structure or components as the Amimo acid sequence is similar to the original one.

Mutated 4- TAC AC​​​​​A TTG GCG ACT

mRNA-. AUG UG​​​U​​​​ AAC CGC UGA

AA seq- met- cys- asn- arg- stop

Mutation- pont mutation (missense)

Effects- yes, due to mutation in single Nucleotide, one different amino acid is formed which again will result in different protein synthesis.

Mutated-5 - TAC ACC TTG G-G ACT

mRNA-. AUG UGG AAC CCU GA

AA seq- met- trp- asn- pro

Mutation- Frameshift deletion

Effects- yes , due to Frameshift deletion, the sequence of nucleotides is changed and hence the protein synthesis is not complete.

If you like my answer please upvote.

Add a comment
Know the answer?
Add Answer to:
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift -...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino aci...

    Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4 Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...

  • can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...

    can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...

  • Mutations Worksheet-Dcletlon, Inserilon & Substitution

    Mutations Worksheet-Dcletlon, Inserilon & SubstitutionThere are several types of mutations:> DELETION (a base is lost/deleted)> INSERTION (an extra base is added/inserted)- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)- If a substitution changes the amino acid, it's called a MISSENSE mutation- If a substitution does not change the amino add, it's called a SILENT mutation- If a...

  • 11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or...

    11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.

  • I have the answers to PART I, I need PART II please. PART I 1. Translate...

    I have the answers to PART I, I need PART II please. PART I 1. Translate the following sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 2. Create one or more point mutations in this sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 3. Translate your mutated sequence. 4. Now, create a frameshift mutation by adding one or more bases. AUG GAG...

  • 3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the...

    3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...

  • Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...

    Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....

  • Match each mutation with its appropriate description. A mutation that changes a codon that specifies an...

    Match each mutation with its appropriate description. A mutation that changes a codon that specifies an amino acid to a stop codon, resulting in premature termination of polypeptide synthesis. Silent mutation Frameshift mutation A mutation that results in a change in a codon such that a different amino acid is specified es Missense mutation A mutation that changes one codon to a different codon that specifies the same amino acid, such that there is no change in the resulting polypeptide....

  • The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a....

    The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...

  • 16. There is a mutation causing an insertion in the above sequence indicated by the underlined...

    16. There is a mutation causing an insertion in the above sequence indicated by the underlined nucleotide. 5'-AAGCCATGGGCACTGGAGGTCGGATGAAACATG3'. What kind of mutation is this? a. Silent b. Missense c. Nonsense d. Frameshift e. Deletion

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT