Frameshift
Missense mutation
This type of mutation is a change in one DNA base pair that results
in the substitution of one amino acid for another in the protein
made by a gene.
Nonsense mutation
A nonsense mutation is also a change in one DNA base pair. Instead
of substituting one amino acid for another, however, the altered
DNA sequence prematurely signals the cell to stop building a
protein. This type of mutation results in a shortened protein that
may function improperly or not at all.
Insertion
An insertion changes the number of DNA bases in a gene by adding a
piece of DNA. As a result, the protein made by the gene may not
function properly.
Deletion
A deletion changes the number of DNA bases by removing a piece of
DNA. Small deletions may remove one or a few base pairs within a
gene, while larger deletions can remove an entire gene or several
neighboring genes. The deleted DNA may alter the function of the
resulting protein(s).
Duplication
A duplication consists of a piece of DNA that is abnormally copied
one or more times. This type of mutation may alter the function of
the resulting protein.
Frameshift mutation
This type of mutation occurs when the addition or loss of DNA bases
changes a gene's reading frame. A reading frame consists of groups
of 3 bases that each code for one amino acid. A frameshift mutation
shifts the grouping of these bases and changes the code for amino
acids. The resulting protein is usually nonfunctional. Insertions,
deletions, and duplications can all be frameshift mutations.
Repeat expansion
Nucleotide repeats are short DNA sequences that are repeated a
number of times in a row. For example, a trinucleotide repeat is
made up of 3-base-pair sequences, and a tetranucleotide repeat is
made up of 4-base-pair sequences. A repeat expansion is a mutation
that increases the number of times that the short DNA sequence is
repeated. This type of mutation can cause the resulting protein to
function improperly.
If you find the answer useful then please hit the like button.
16. There is a mutation causing an insertion in the above sequence indicated by the underlined...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.
2. If a mutation occurs and alters the sequence CGATATGA to CGATATCA what will be the final effect - compared to the protein that was supposed to be made, how would the actual protein that is synthesized (made) look -shorter, longer or same? 3. Give the sequence of the protein that would result from such a mutation (mutation in question 4. What is the name given to such a mutation? Be specific (answer is not point mutation, deletion, insertion, substitution...
Question 6 6. (1pts) The following DNA sequence 5-AGTCGCCCATGCCG-3' undergoes a mutation in which an A nucleotide is inserted at the 5' end of the molecule. How would you classify this mutation? Frameshift mutation Silent mutation Nonsense Mutation Missense mutation
A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3' wild-type (normal) sequence 5' ATG TTC TAG CCA 3' mutant sequence a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this classification.
Mutations Worksheet-Dcletlon, Inserilon & SubstitutionThere are several types of mutations:> DELETION (a base is lost/deleted)> INSERTION (an extra base is added/inserted)- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)- If a substitution changes the amino acid, it's called a MISSENSE mutation- If a substitution does not change the amino add, it's called a SILENT mutation- If a...
2. The following is a short mRNA. (Note: I have given you the mRNA already so just translate what I have given you. 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUpuAGAUAGAGUGGG3 a. What is the amino acid sequence of the protein encoded for by this gene? b. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5 CUCUACCUGGGGUGUAGAUGCACCUTGAAGGAGGGAUUCGUUUUAGAUAGAGUGGG3 c. If the gene above in "a" picks up...
If the wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the sequence to THE CAT ATT HEB IGR AT? a. missense b. nonsense c. deletion d. insertion e. silent
A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3' wild-type (normal) sequence 5' ATG TTG CCC CAT 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...