Mutations Worksheet-Dcletlon, Inserilon & Substitution
There are several types of mutations:
> DELETION (a base is lost/deleted)
> INSERTION (an extra base is added/inserted)
- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"
changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)
- If a substitution changes the amino acid, it's called a MISSENSE mutation
- If a substitution does not change the amino add, it's called a SILENT mutation
- If a substitution changes the amino acid to a "stop," it's called a NONSENSE mutation
Complete the boxes below. Classify each as Deletion, Insertion or Substitution AND as either frameshift, missense, silent or nonsense (Hint: Deletion & Insertion will always be frameshift).


Which of the following mutations could result in a truncated protein? Choose all that apply. A missense mutation that changes a phenylalanine to a leucine O A two base pair frameshift O An in-frame removal of three base pairs O A one base pair frameshift A chromosomal-level deletion O o A chromosomal-level insertion O A nonsense mutation that changes a cysteine to a stop codon
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an amino acid to a stop codon, resulting in premature termination of polypeptide synthesis. Silent mutation Frameshift mutation A mutation that results in a change in a codon such that a different amino acid is specified es Missense mutation A mutation that changes one codon to a different codon that specifies the same amino acid, such that there is no change in the resulting polypeptide....
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3' wild-type (normal) sequence 5' ATG TTC TAG CCA 3' mutant sequence a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this classification.
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3' wild-type (normal) sequence 5' ATG TTG CCC CAT 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you...
How many different mutations can result from a single base pair substitution in the unique tryptophan codon? Classify each as silent, missense, or nonsense.
An important validation of the genetic code occurred when George
Streisinger determined the amino acid sequence of bacteriophage T4
lysozyme and of mutants induced by proflavin, a dye with a planar
structure that can intercalate (fit) between successive base pairs
in DNA and induce frameshift mutations−that is, mutations involving
additions or deletions of a single base. Streisinger and colleagues
found that a particular single-base insertion mutation could be
suppressed, with wild-type function restored, by a mutation that
evidently involved a...