I have the answers to PART I, I need PART II please.
PART I
1. Translate the following sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG
2. Create one or more point mutations in this sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG
3. Translate your mutated sequence.
4. Now, create a frameshift mutation by adding one or more bases. AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG
5. Translate your mutated sequence.
6. Create a frameshift mutation by deleting one or more bases. AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG
7. Translate your mutated sequence.
8. Align the amino acid sequences that you determined for each of the four transcripts.
PART II Post-Lab Questions
1. How does each of your mutations affect the amino acid sequences? Are the mutations missense mutations, silent mutations or nonsense mutations?
a. Point mutation?
b. Frameshift-insertion?
c. Frameshift-deletion?
2. What differences did you notice between the point mutation and the frameshift mutations?
3. Is it possible to determine the DNA sequence from the amino acid sequence Leu Pro Arg? Why or Why not?
1. a.
Point muation
AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUA GCU CUU AGU GAU GUU UAG
When in this sequence , fourth base change from A To U., amino acid change from methionine to stop cidob. This is an example of non-sense mutation.
b. Frame shift insertion
When in this sequence, A is inserted into begging of sequence, first Codon become AUU from AUG, the amino acid from changes from mehionine to isoleucine. This is an example of missense
c. Frame shift deletion
When in the given sequence, if first base is deleted, that is A is deleted , the first Codon become AUG to UGG, the amino acid become trytophan from methione. This is an example of mis -sense mutation.
2. Point mutation is the change in one nucleotide and do not change the frame of codon but in frameshift mutation, frame of Codon is changed.
3. Yes, it is possible to determine DNA sequence from amino acid sequence because each amino acid have specific Codon.
For example, in this question , Leu Pro Arg
The DNA sequence is CUU CCU AGA
Note:
This sequence could be another codon for the amino acid. For example,
Arginine is coded by two Codon AGA and AGG.
I have the answers to PART I, I need PART II please. PART I 1. Translate...
Need some help with an exercise in my biology
course.
& Genetic Mutations X 2. Lab12. eScience Transcription X + Chapter 13.2 х /sites/default/files/V3/Biology/2nd_Edition General_Biology/Docs/GB_1713_L12 Transcription_and_Translation/GB_1713_112_Exp2 Mutations.pdf Exercise Genetic Mut Experiment Inventory Materials No materials required EXERCISE 2: GENETIC MUTATIONS 1. Translate the following sequence: AUG GAG GUC UUU AAG AGA CAU VUA GAU GUA GCC CUU AGU GAU GUU UAG 12. Create one or more point mutations in this sequence: AUG GAG GUC UUU AAG AGA CAU VUA GAU...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Bring this DNA sequence to protein using the transcription
(3pts) and translation (4 pts) processes.
note: Pending the direction your DNA is located
Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
1. You are a scientist studying a rare heritable disease, Pitt-Hopkins syndrome. This disease is caused by mutations in the basic helix-loop-helix transcription factor, TCF4. You sequence the TCF4 gene in your patients and identify several sequence variants. a) The TCF4 coding region and sites of mutations for several patients are shown here (lines between codons indicate the open reading frame). For each patient, identify the impact of the mutation on the coding sequence (1 mark each) and the likely...
You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio of 16:3A. What is the probability of obtaining a glycine (gly) codon? second base U UAU tyr DỤC phe UUA leu UACS UAA Stop UAG Stop G UGU UGC ſys UGA Stop UGG trp CGU CGC CAU , his CÁC his CỦA / leu CAA 1. arg CGA с UUU 2 UCU UCC ser UCA UUG) UCG CUU CCU CUC CCC CCA } pro...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...