a. Lower strand is used in transcription, because it is the lower strand is in 3' to 5' direction. The mRNA is transcribed in 5' to 3' direction.
b. pro-val-ala-gln-ile-none-ile-ser-phe-leu-his-arg-ile-ala-cys-none-ser-none-tyr-ala-gln-arg
c.

tRNA ihas anticodon for the aminoacid. The mRNA has the codon for the aminoacid.
RNA transcription always occurs in 5' to 3' direction. UAG,UGA,UAA are the stop codons. So no aminoa cid is coded for these codons.
2. The following sequence is a wild-type gene that encodes a tRNA-his molecule that recognizes the...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
The sequence of the gene for alcohol dehydrogenase is shown below. AATGCGTTTACCAAGCGTACAGTGTGCAAA Write the complementary strand of nucleic acid that would be synthesized during transcription below the original strand. 2 pts) How many codons are in the alcohol dehydrogenase Rene? (1 pt) How many amino acids would be in the alcohol dehydrogenase enzyme? (1 pt) TRANSLATION 1 codon base pairs (1 pt) 1 codon amino acids (1 pt) 3 base pairs = amino acids (1 pt) A molecule of tRNA...
A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The intron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly-A tails are added following the sequence AGUUGG. The poly-A tails are 20 nucleotides. b. If this is an oncogene that is elevated in cancer cells, design two siRNAs to knock down the mRNA, list the sequences of the siRNAs...
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...
Below is the coding DNA sequence for a gene called tribble, including the wild-type and several mutant alleles. For each mutant allele, fully classify the mutation and its effect in the amino acid sequence. Wild-type 5'-ATGGCAACTACATATAGCACAGTTTGAACC-3' a. Mutant allele #1 5'-ATGGCAACTACATAAAGCACAGTTTGAACC-3' b. Mutant allele #2 5'-ATGGCAACTACATATAGCATAGTTTGAACC-3' c. Mutant allele #3 5'-ATGGCAACTACATACAGCACAGTTTGAACC-3' d. Which mutant allele is most likely to be a knockout and why?
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...