Question

Below is the coding DNA sequence for a gene called tribble, including the wild-type and several mutant alleles. For each muta

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Wildtype DNA sequence:

5'-ATGGCAACTACATATAGCACAGTTTGAACC-3

mRNA : 5'-AUGGCAACUACAUAUAGCACAGUUUGAACC-3'

polypeptide: Met-Ala-Thr-Thr-Tyr-Ser-Thr-Val

The provided DNA sequence is the coding strand of the DNA.

a.

Mutant 1:

DNA : 5'-ATGGCAACTACATAAAGCACAGTTTGAACC-3'

mRNA: 5'-AUGGCAACUACAUAAAGCACAGUUUGAACC-3'

polypeptide: Met-Ala-Thr-Thr

Because UAA is a stop codon.

This type of point mutation is known as Nonsense mutation. It leads to premature termination of translation.

b.

Mutant 2 :

DNA :5'-ATGGCAACTACATATAGCATAGTTTGAACC-3'

mRNA: 5'-AUGGCAACUACAUAUAGCAUAGUUUGAACC-3

polypeptide: Met-Ala-Thr-Thr-Tyr-Ser-Ile-Val

This type of mutation is called missense mutation. This mutation is a change in one DNA base pair that leads to substitution of one amino acid to another .

c.

Mutant 3 :

DNA : 5'-ATGGCAACTACATACAGCACAGTTTGAACC-3'

mRNA : 5'-AUGGCAACUACAUACAGCACAGUUUGAACC-3'

Polypeptide: Met-Ala-Thr-Thr-Tyr-Ser-Thr-Val

This is a silent mutation. The mutation have no affect on the polypeptide. The nucleotide substitution results to a change which codes for the same amino acid.

d.

Mutant 1 is most likely to knockout. Because it results into a truncated most probably nonfunctional protein.

Add a comment
Know the answer?
Add Answer to:
Below is the coding DNA sequence for a gene called tribble, including the wild-type and several...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 12) A particular allele of a gene (including the wild-type allele) can be expressed in a...

    12) A particular allele of a gene (including the wild-type allele) can be expressed in a dominant fashion for several reasons A) Explain why wild-type alleles are usually dominant to mutant alleles (5 pts.). 20 B) Describe three ways in which mutant alleles can be dominant to a wild-type allele (6 pts.).

  • 12) A particular allele of a gene (including the wild-type allele) can be expressed in a...

    12) A particular allele of a gene (including the wild-type allele) can be expressed in a dominant fashion for several reasons- A) Explain why wild-type alleles are usually dominant to mutant alleles (5 pts.). B) Describe three ways in which mutant alleles can be dominant to a wild-type allele (6 pts.). 13) Explain how chromatids/chromosomes move to opposite poles of the cell during anaphase. Be sure to mention in your answer how the force that propels this movement is generated...

  • 1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription...

    1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription start site is in bold (+1). Draw boxes around and label the consensus sequences found in this type of promoter. 5' AGTTAGGTATTGACATGATAGAAGCACTCTACTATAATTCAATAGGTCCAC 3 2) A partial peptide sequence for the wild type and three mutant alleles of a gene, PET1, are shown below. Each mutant was caused by a substitution, addition, or deletion of a single nucleotide. Determine the exact coding DNA sequence of...

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • Shown below is the sequence of a coding strand of DNA that begins with what corresponds...

    Shown below is the sequence of a coding strand of DNA that begins with what corresponds to the translation start codon (AUG) in the mRNA transcript. You are analyzing two different mutants. Mutant #1 has an extra C residue after the underlined G residue and Mutant 2 has a deletion of the underlined A residue. Wild type 5’- ATGCTTACTGAGGTCATGGTACAGATGA Mutant 1 5’- ATGCTTACTGCAGGTCATGGTACAGATGA Mutant 2 5’- ATGCTTACTGAGGTCATGGTCAGATGA What is the amino acid sequence of the polypeptide encoded by: B. The...

  • 4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This...

    4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...

  • Consider the most common Cystic Fibrosis variant: Wild-type CFTR DNA (Coding-strand): 3 ATC ATC TTT GGT...

    Consider the most common Cystic Fibrosis variant: Wild-type CFTR DNA (Coding-strand): 3 ATC ATC TTT GGT GTT atc att ggt gtt... Cystic Fibrosis odi 1. Add the 5' and 3' designations to the DNA. 2. Write the template sequence for the DNA 3. Transcribe the wild-type and CF DNA into mRNA. Be sure to include the 5'/3' labels. 4. Translate the wild-type and CF mRNA into protein. Be sure to label these ends also. 5. In the above wild-type protein,...

  • The answer is C but why? 15. Below is the middle region of a particular polypeptide....

    The answer is C but why? 15. Below is the middle region of a particular polypeptide. The wild-type amino acid sequence and the sequence of several mutant polypeptides are given ( ... indicates additional, unspecified amino acids). Which of the five mutant polypeptides is most likely to be the result of a nonsense mutation in the corresponding gene? a. mutant 1 b. mutant 2c. mutant 3d. mutant 4e. mutant 5

  • The answer is C but why? 15. Below is the middle region of a particular polypeptide....

    The answer is C but why? 15. Below is the middle region of a particular polypeptide. The wild-type amino acid sequence and the sequence of several mutant polypeptides are given ( ... indicates additional, unspecified amino acids). Which of the five mutant polypeptides is most likely to be the result of a nonsense mutation in the corresponding gene? a. mutant 1 b. mutant 2c. mutant 3d. mutant 4e. mutant 5

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT