Homework Answers
Add Answer to:
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, ch...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons? Match t...
What is the minumum number of tRNA molecules that a cell must
contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in
the sentences on the right.
second tRNAs with variations each in the positions would sixty one tRNAs suffice to translate sixteen amino acids. Because of wobble in the position, only variations suffice to translate all twenty amino acids. Therefore, sixteen should be the minimum needed to translate...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
22. The wobble rules for tRNA-mRNA pairing are shown in Figure 15.12b. If we assume that...
22. The wobble rules for tRNA-mRNA pairing are shown in Figure 15.12b. If we assume that the tRNAS do not contain modified bases, what is the minimum number of tRNAs needed to efficiently recognize the codons for the following types of amino acids? a. Leucine b. Methionine c. Serine Phenylalanine Third base of mRNA codon AAG ... Base in anticodon can be U, 1, xm sau. xm Um, Um, xmu.xou, k2C A, G, U. 1, xoSu C, A, U, XOSU...
What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons? Match the words in the left column to the appropriate blanks in the sentences on the ri...
What is the minumum number of tRNA molecules that a cell must
contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in
the sentences on the right.
three tRNAs with variations each in the positions would thirty two tRNAs suffice to translate sixteen amino acids. Because of wobble in the position, only variations suffice to translate all twenty amino acids. Therefore, sixty one tRNAS should be the minimum needed...
Refer to the wobble rules for tRNA–mRNA pairing I presented in class (also see your textbook)....
Refer to the wobble rules for tRNA–mRNA pairing I presented in class (also see your textbook). If we assume that the tRNAs contain no modified bases (e.g., inosine), what is the minimum number of tRNAs that are needed to efficiently recognize the codons for the following amino acids? Please provide the anticodon sequence (& polarity) for each of the tRNAs. a) Arginine b) Serine c) Proline d) Tyrosine
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
21. One form of thalassemia has a single G->A mutation in the B-globin gene at the...
21. One form of thalassemia has a single G->A mutation in the B-globin gene at the first nucleotide in the intron. This destroys the S' splice junction. The mRNA remains unspliced, leaving nucleotide intron in place. Assuming no stop codons are introduced in the intron pro second exon would be in-frame or out of frame in the translated protein dict if the A. In frame B. Out of frame Phe Ser Ty Cys U Phe Ser Cys Leu Se Stop...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence,...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters...
5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters in the alphabet to encode 20 amino acids. DNA on the planet Arth only contains A, G and C. In addition, proteins on Arth are made from 26 different amino acids. What is the minimum number of nucleotides in a codon needed to code for life on Arth? Hint: In humans a 3-letter code can represent 4 x 4 x4 = 64 amino acids...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
What is the minumum number of tRNA molecules that a cell must
contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in
the sentences on the right.
second tRNAs with variations each in the positions would sixty one tRNAs suffice to translate sixteen amino acids. Because of wobble in the position, only variations suffice to translate all twenty amino acids. Therefore, sixteen should be the minimum needed to translate...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
22. The wobble rules for tRNA-mRNA pairing are shown in Figure 15.12b. If we assume that the tRNAS do not contain modified bases, what is the minimum number of tRNAs needed to efficiently recognize the codons for the following types of amino acids? a. Leucine b. Methionine c. Serine Phenylalanine Third base of mRNA codon AAG ... Base in anticodon can be U, 1, xm sau. xm Um, Um, xmu.xou, k2C A, G, U. 1, xoSu C, A, U, XOSU...
What is the minumum number of tRNA molecules that a cell must
contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in
the sentences on the right.
three tRNAs with variations each in the positions would thirty two tRNAs suffice to translate sixteen amino acids. Because of wobble in the position, only variations suffice to translate all twenty amino acids. Therefore, sixty one tRNAS should be the minimum needed...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
21. One form of thalassemia has a single G->A mutation in the B-globin gene at the first nucleotide in the intron. This destroys the S' splice junction. The mRNA remains unspliced, leaving nucleotide intron in place. Assuming no stop codons are introduced in the intron pro second exon would be in-frame or out of frame in the translated protein dict if the A. In frame B. Out of frame Phe Ser Ty Cys U Phe Ser Cys Leu Se Stop...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters in the alphabet to encode 20 amino acids. DNA on the planet Arth only contains A, G and C. In addition, proteins on Arth are made from 26 different amino acids. What is the minimum number of nucleotides in a codon needed to code for life on Arth? Hint: In humans a 3-letter code can represent 4 x 4 x4 = 64 amino acids...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago