What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in the sentences on the right.
Homework Answers
Add Answer to:
What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons? Match t...
What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons? Match the words in the left column to the appropriate blanks in the sentences on the ri...
What is the minumum number of tRNA molecules that a cell must
contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in
the sentences on the right.
three tRNAs with variations each in the positions would thirty two tRNAs suffice to translate sixteen amino acids. Because of wobble in the position, only variations suffice to translate all twenty amino acids. Therefore, sixty one tRNAS should be the minimum needed...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
14. Select the number of participants in the Beck & Watson study Group of answer choices...
14. Select the number of participants in the Beck & Watson
study
Group of answer choices
8
13
22
35
15. Beck & Watson determined their final sample size via
Group of answer choices
coding
saturation
triangulation
ethnography
16.Through their study, Beck & Watson determined
Group of answer choices
after a traumatic birth, subsequent births have no troubling
effects
after a traumatic birth, subsequent births brought fear, terror,
anxiety, and dread
Subsequent Childbirth After a Previous Traumatic Birth Beck, Cheryl...
THE COMPANY: MORE POWER, INC. More Power, Inc., is a large, local retail store specializing in...
THE COMPANY: MORE POWER, INC. More Power, Inc., is a large, local retail store specializing in the sale and service of hardware, tools, lawn and garden implements, and other materials for the home. More Power operates seven days a week, dawn to dusk. Approximately 120 employees work in distinct divisions within the store, including customer service/return desk; warehouse and delivery; service and repair; and three distinct sections focused on (1) hardware and tools, (2) lawn and garden and outdoors, and...
10. The Beck & Watson article is a Group of answer choices quantitative study qualitative study...
10. The Beck & Watson article is a
Group of answer choices
quantitative study
qualitative study
11. Beck & Watson examined participants' experiences and
perceptions using what type of research design?
Group of answer choices
particpant obersvation
phenomenology
12. Select the participants in the Beck & Watson study
Group of answer choices
Caucasian women with 2-4 children
Caucasian pregnant women
13. In the Beck & Watson study, data was collected via
a(n)
Group of answer choices
internet study
focus group...
I need Summary of this Paper i dont need long summary i need What methodology they used , what is the purpose of this p...
I need Summary of this Paper i dont need long summary i need
What methodology they used , what is the purpose of this paper and
some conclusions and contributes of this paper. I need this for my
Finishing Project so i need this ASAP please ( IN 1-2-3 HOURS
PLEASE !!!)
Budgetary Policy and Economic Growth Errol D'Souza The share of capital expenditures in government expenditures has been slipping and the tax reforms have not yet improved the income...
What is the minumum number of tRNA molecules that a cell must
contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in
the sentences on the right.
three tRNAs with variations each in the positions would thirty two tRNAs suffice to translate sixteen amino acids. Because of wobble in the position, only variations suffice to translate all twenty amino acids. Therefore, sixty one tRNAS should be the minimum needed...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
14. Select the number of participants in the Beck & Watson
study
Group of answer choices
8
13
22
35
15. Beck & Watson determined their final sample size via
Group of answer choices
coding
saturation
triangulation
ethnography
16.Through their study, Beck & Watson determined
Group of answer choices
after a traumatic birth, subsequent births have no troubling
effects
after a traumatic birth, subsequent births brought fear, terror,
anxiety, and dread
Subsequent Childbirth After a Previous Traumatic Birth Beck, Cheryl...
10. The Beck & Watson article is a
Group of answer choices
quantitative study
qualitative study
11. Beck & Watson examined participants' experiences and
perceptions using what type of research design?
Group of answer choices
particpant obersvation
phenomenology
12. Select the participants in the Beck & Watson study
Group of answer choices
Caucasian women with 2-4 children
Caucasian pregnant women
13. In the Beck & Watson study, data was collected via
a(n)
Group of answer choices
internet study
focus group...
I need Summary of this Paper i dont need long summary i need
What methodology they used , what is the purpose of this paper and
some conclusions and contributes of this paper. I need this for my
Finishing Project so i need this ASAP please ( IN 1-2-3 HOURS
PLEASE !!!)
Budgetary Policy and Economic Growth Errol D'Souza The share of capital expenditures in government expenditures has been slipping and the tax reforms have not yet improved the income...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago