Original DNA & mRNA:
DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5'
mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU - 3'
What effect would the following DNA mutation have on the polypeptide synthesized from the gene?
DNA template: 3' - GGGTTCGGCTCTAAA(300b)TACCCGATCGTA - 5'
mRNA: 5' - CCCAAGCCGAGAUUU(300b)AUGGGCUAGCAU - 3'
|
There will be no effect because the codon still calls for the same amino acid. |
||
|
The polypeptide's synthesis will stop too soon because a stop codon has been introduced too early in the sequence. |
||
|
A single amino acid would be changed because AUG and AAG call for different amino acids, but everything else will remain the same. |
||
|
The first part of the polypeptide would be missing and the reading frame could be off because the normal start codon has been changed and is no longer a start codon. |
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU -...
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG . For the following DNA template strand, determine the mRNA strand and the polypeptide chain DNA 3' TACTTCCCAAAGCGCTACCCGGCAATC 5 RNA Polypeptide Chain • For the following DNA template strand, determine the mRNA strand, the polypeptide chain and the tRNA anti-codons. DNA 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5 Alaud dha falla una line and now thanenin muth
hi please help. im having trouble with transcribing the given
dna fragment!
1. A double stranded DNA has the following sequence: +1 5' GGCGGCGGCTGCCTATGCTGGCTTCAGCGTAGGCGTAC 3' coding strand TIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 3' CCGCCGCCGACGGATACGACCGAAGTCGCATCCGCATG 5' A UUU UAUTY ser UCO Stog Transcribe the given DNA fragment (5-GGC GGA UGC CUC GGC UGG CUU AAG CGG AC 5'UTR (highlight in green) Second Letter с 3' UTR (highlight in blue Start Codon (highlight in yellow) VUC ) Stop Codon (highlight in red) Open reading frame (enter...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...
A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC CAC CGC 3'. Assume the first codon for the peptide begins with the first nucleotide of the portion of mRNA and there are no introns (May not start at AUG). Enter the mRNA and amino acid sequence below
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
In the diagram below find • 1. mRNA • 2. tRNA . 3. polypeptide B С A D PA MANGAN Start codon Stop codon In the following diagram of translation find: 4. 30S ribosomal subunit 5. RNA 6. mRNA 7. Amino acid 8. A site 9. Anticodon 10. Start codon A G D H AUG E B
Recall that DNA is a template for mRNA. Every three mRNA nucleotides make up a codon which corresponds to a specific amino acid. The properties of the amino acids determine how the protein folds. Explain how the differences in each of the DNA sequences used still allow each organism to make the same functional protein. (Note: A chart showing amino acids and the corresponding DNA genetic code may be useful. You can search for this online using the term “DNA...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence